I have extracted DNA from FFPE tissues (7 - 9 years ago) using Qiagen FFPE kits. I measured the DNA concentration by nanodrop and loaded ~16-20ng DNA to 1.5% gel, but it seems to me there's nothing.
Should I observe smear DNA? Or is there any other way to assess the quality of DNA obtained from FFPE tissues?
Many thanks.
Usually the quality is poor depends on how harsh was the fixative and the processing and preservation. I would recommend that you perform a single PCR with a housekeeping gene using the necessary controls to reach a decision.
I have used the same method and got a very good quality DNA. But still this depends on the quality of fixation and the process of deparrfinazation you did before extraction. The problem is that DNA from parrafin waxed tissue blocks is usually fragmented and you need he design a very short primers to be able to analyze your gene. So you have to put this point in your mind before starting.
i found hose two papers which might be of help to you:-
http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0000537
http://www.medsci.org/v11p0494.htm
good luck,
Mona
When you say nanodrop, I assumed you measured the DNA by spectrophotometry. A better alternative is to use DNA-intercalating dyes like picogreen and measure fluorimetrically with them. However, if you want your DNA for later PCR, I would do as Eman El-Abd suggest and check directly the PCR amplifiability.
We use universal eukaryotic primers with TaqMan probe for our checking of amplifiability. The problem there is, they amplify also the human DNA of people performing the experiments and we were never able to completely eliminate amplification in negative controls. If you notice the same problem, you need to use fewer PCR cycles, to have your negative control as negative. Alternatively, you can use real-time PCR, in which case, your sample DNA should amplify much earlier than negative control. Also, the primers I am talking about are targeting a multicopy gene (18s rRNA), so if you later plan on working with low copy genes, keep in mind they will amplify less than this universal eukaryotic target. I will give you the sequences. But maybe you will find more suitable hosekeeping gene for yourself.
Primers: 18sdir TGGTGCCAGCAGCCGC, 18sinv TCCAACTACGAGCTTTTTAACTGCA, Probe (labeled with FAM-TAMRA, or FAM-BHQ etc): 18sP CGCTATTGGAGCTGGAATTACC, Source: Pegels N, González I, Martín I, Rojas M, García T, Martín R. Applicability assessment of a real-time PCR assay for the specific detection of bovine, ovine and caprine material in feedstuffs. Food Control. 2011;22:1189-96.
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Biomolecules
- Nucleic Acids
- DNA