Does T cell activation via plate-bound anti-CD3 simulate any aspect of physiological T cell priming?

Chamila Deshani Ranawakage @Chamila-Ranawakage

15 April 2015 1 9K Report

Could you please help me to figure out how can I relate T cell activation via plate-bound anti-CD3 with physiological situation in which T cells are primed by antigen bound dendritic cells or any APC. Isn't this system too artificial and how can we rely on our observations?

Chamila Deshani Ranawakage

Thanks a lot Siva., In fact I'm using DO11.10 hybridoma T cells and even without CD28 plate bound anti-CD3 gives a strong T cell stimulation.

Badges
Science topic

More Chamila Deshani Ranawakage's questions See All

How to select research sample scientifically?

population is 100000, they in 250 1AB, 1C category of schools in 3 district. I want select the sample considering school category, district, and gender equality . how many unite should I select?...

08 October 2023 3,047 0 View

Regarding WGS analysis?

Any one is using MYKROBE for analysis of WGS data .I want to know about interpretation

13 September 2020 2,751 2 View

Annealing temperature for a primer set for ampliofication of pncA gene in MTB ? ?

Please let me know the thermocylin parameter for amplification of pncA gene in MTB using following primer set if any one use this pncA_F3 (AAGGCCGCGATGACACCTCT) and pncA_R4...

25 June 2019 9,278 3 View

Can we evaluate CRISPR/Cas9 Knock-in efficiency by q-PCR?

CRISPR/Cas9-mediated HDR-induced Knock-in (KI) in zebrafish seems to yield very low efficiency in germ-line transmission. To obtain a higher efficiency, we may need to optimize several factors...

02 March 2019 2,930 5 View

Can someone explain the ontology and epistemology in simple way?

the ontology and epistemology is complex phenomenon to understand the nature of research. In my case i need to understand both regarding with my research. So need to understand the simple meaning...

16 February 2017 4,303 90 View

Regarding MIRU-VNTR typing?

I am trying to use genemapper 4 for analysis MIRU-VNRT typing of M. tuberculosis. But, I can insert only 1-9 repeats in the Bin.If some one use genemapper for Tuberculosis typing please help me.

29 March 2016 807 0 View

I am getting a problem in DNA Sequencing as having wide peaks in the chromatography. Any one has idea to solve this?

I am using cleaned PCR product of fragment of rpoB gene of M.tuberculosis. PCR products are cleaned by Exo-Sap and after cycle sequencing purification is done by the sodium acetate method.

06 March 2016 8,011 5 View

Can a fluorescent chimera protein give fluorescent signal even if it is misfolded?

I fused mCherry into the C-terminus of transferrin receptor (TfR) which is a type-2 transmembrane protein (2292bp). So, mCherry supposed to express out side of the cell. During the confocal...

02 June 2015 1,820 5 View

Does activated mouse T cells express MHC class II?

Although there are several lines of evidences suggesting the expression of MHC class II in activated mouse T cells the acceptance seems to be controversial. Please help me for any confirmation...

30 September 2014 8,541 7 View

What is the best software to get Phonon DOS from VACF of the a MD simulation?

nMOLDYN has the capability to use the velocity auto correlation function to obtain the phonon density of state for an NVT simulation. There are problems with normalization of the spectra. Does...

10 March 2014 9,735 3 View

Why Do TDS and EC Increase with Larger Wastewater Volumes, While BOD and COD Decrease?

I have carried out MFC experiments on three different volumes, 50, 500 and 1000 mL of wastewater. Results after MFC treatment shows that TDS and EC are more in larger volumes of water i.e. TDS and...

09 August 2024 9,621 0 View

Could it be a cell culture contamination?

Hello everyone! I observed in my culture (htert-RPE1 cells) an orange- red particle at the bottom of the dish. It is visible to the naked eye as a very very small red dot. Could it be a...

09 August 2024 2,824 3 View

Is there any way to quantify bacterial and fungal cells in their mixed culture?

I am working in fungal fermentation of soybean meal and there is bacterial growth in them at times. I am trying to quantify fungal cell counts and bacterial cells; but I haven't been able to do at...

07 August 2024 7,535 4 View

How to normalize and take the significance of the MTT OD values with 3 replicates for the same cell-line?

Hi, I have a question about normalizing the MTT OD values for doing the statistical analysis. So, if we have 3 different plates and we call them 3 different replicates, so, first we would...

07 August 2024 8,106 4 View

Why activated CAR-Jurkat cell could not kill targets?

Previously when I co-coluture anti-CD19(FMC63) CAR-Jurkat with Raji with E:T=5:1, Jurkat can eliminate Raji in 24h. However, when I test another CAR construct, although I can dectect totally CD69...

06 August 2024 641 2 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

The Curse of Evolution and Complexity?

Brain and body mass together are positively correlated with lifespan (Hofman 1993). The duration of neural development is one of the best predictors of brain size, and conception is the best...

05 August 2024 6,247 3 View

How to isolate lymphocytes from mouse spleen?

I have tried several times to isolate lymphocytes from mouse spleen, but all attempts have been unsuccessful. I tried most available protocols. I used different dissociation media (HBSS with Ca...

04 August 2024 9,913 7 View

How to Add Missing Water Molecules in Protein-Membrane Simulations?

I have protein-membrane simulations (PDB, PSF, DCD) and have noticed that water molecules near the protein are not visible in the simulations. How can I fix this issue? Is there a way to place the...

04 August 2024 1,200 2 View

Does long-term culture of murine Monocytes result in macrophage differentiation?

Hi, I am isolating monocytes from the bone marrow using the Mouse Monocyte EasySep kit. I want to treat these cells and monitor expression of specific markers over the course of 10 days. I will...

04 August 2024 7,282 2 View