Does anyone have a plasmid for Otx5 ISH probe for zebrafish?

More Monika Gostic's questions See All

I want to remove Urea from my protein sample?

I want to remove Urea from my protein (6kDa) sample. I did use : 1. Step down the Urea gradient (dialysis) in order to remove urea and refold my protein, but my protein still contains urea in the...

06 August 2024 1,350 4 View

How to perform EEG source analysis on each trial of data separately?

Hello Everyone I have a question about structure for connectivity analysis on sources. My goal: preprocess and cut data into trials create headmodels, using template MRI file perform source...

30 July 2024 2,744 1 View

How to draw photon-magnon coupling color plot in origin?

Please help me in plotting the photon-magnon coupling plot as shown below

14 July 2024 1,632 1 View

Should the final concentration of DMSO in the wells of the plate be the same for different concentrations of compounds - studies on cells?

Hi, My research will consist in examining the effect of compounds at concentrations of 10(-4)M, 10(-5)M, 10(-6)M, 10(-7)M, 10(-8)M on cells. I prepared 100 mM stocks of compounds in 100% DMSO....

21 April 2024 3,032 0 View

What software do I use for brine wastewater nutrient and mineral, biological statistical data analysis and how do I use them?

Good day Water, marine Biologist scientist, Environmental Engineers,and Industrial Ingineers, chemists and chemical Engineers experts I hope this message finds you well. I am currently serving as...

06 April 2024 3,681 4 View

What is the difference between optical bandgap and electrical bandgap?

how we can interpret it??

18 March 2024 4,915 2 View

What is the amount of radiation in space?

amount of radiation in space

09 March 2024 3,855 0 View

Error reading k point # 1, what parameter I have to change?

I have done ph.x, q2r.x, matdyn.x and have got the output. But, while running plotband.x I am getting error like "error reading k point # 1"

03 March 2024 8,899 0 View

How many atomic bomb surviours of Hiroshima and Nagashaki are still alive ?

Atomic bomb surviours of (out of ~ 105500 or so reported) of Hiroshima and Nagashaki in Japan

02 March 2024 8,583 1 View

What should be the characteristics of Matrix in MALDI -MS to produce (M-H)- ion in negative ion mode?

MALDI( Matrix Assisted Laser desorption Ionization) Matrix use in MALDI in positive mode and negative mode

18 February 2024 5,919 1 View

Hello researchers Is this a random laser or just fluorescence?

I am using Rhodamine6G as gain medium and silver nanoparticles as scatterers on a microscope slide and laser input 532 nm comes from above.

09 August 2024 9,894 2 View

What precautions should be taken while handling S. aureus enterotoxin Type B in the lab?

I would like to understand potential safety concerns while handling SEB in the lab. Especially while working in animal house facility. Would like to know precautions for handling. Sigma MSDS...

07 August 2024 6,034 3 View

How to understand this crystallographic phenomenon of low temperature crystals in zeolite?

During low-temperature testing, new diffraction peaks that appear could be indicative of several phenomena. In one of our tests, we observed notable new peaks around 40° and 45° in a specific...

06 August 2024 726 3 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

How to quantify polystyrene microplastic (8 micron) bioaccumulation in fish tissue?

"I have treated adult zebrafish with 8-micron polystyrene microplastic and want to study the bioaccumulation in different organs. Can this be done using hydrogen peroxide digestion followed by...

05 August 2024 853 3 View

Are there any commercially available Donkey anti-Alpaca secondary antibodies?

Are there any fluorescently labeled anti-Alpaca secondary antibodies raised in Donkey? So far I have only been able to find anti-Alpaca secondaries raised in Goat. Or is this not possible due to...

04 August 2024 4,255 1 View

Why results of ROS flurescence are negative as there was no bacteria within?

Hello. I am working on ROS production of two systems: system A is cerium oxide and hydrogen peroxide, system B is cerium oxide nanoparticle, hydrogen peroxide and potassium bromide. I did some...

04 August 2024 5,974 3 View

How to calculate the molar proportions of the oxides from the XRF analyses?

02 August 2024 2,565 2 View

Dimensions of an MJ Research 96-well alpha module?

Can anyone with an MJ research / BioRad PCR machine from ~2010 or earlier tell me the external measurements (LxWxH) of the removable standard PCR alpha modules that can be removed from a PTC200 or...

30 July 2024 2,867 0 View

Do some Staphylococcus aureus strains have in vitro antimycobacterial activity ?

Some Staphylococcus aureus strains Inhibit the growth of Mycobacteria in Mueller Hinton Agar medium containing 10% OADC. Do some Staphylococcus aureus strains have in vitro antimycobacterial activity?

29 July 2024 10,023 2 View

Thierry Gilbert

Hi Monika,

No more cloning for probe. I order primers to recognize a 700-1000nt fragments, in the 'UTR if possible, the reverse with the sequence CGATGTTAATACGACTCACTATAGGG added in 3'. Two rounds of PCR and you have your template for probe synthesis!

You may contact [email protected], he may have it.

Cheers

Thierry

Monika Gostic

Thank you Thierry, I've sent him an email :) I already have probes but this one would perfectly co-localize with the structures I'm looking into :) So hopefully, I'll get it soon :)