Does anyone have a list of internal standards used in GC-MS based on cuticle waxy compounds?

21 May 2020 0 6K Report

I need a list of an internal standard that can be used for GC-MS based on fruit cuticle waxy compounds.

Thank you in advance

Badges
Science method

More Hafiz Muhammad Rizwan's questions See All

I'm interested to quantify Urea by HPLC method, reversed phase conditions are preferable. Is there a good method suited for urea?

I have to develop a method that can be good enough to run dozens of samples that include urea as the main compound. I prefer an HPLC method because of the convenience of running large numbers of...

01 February 2021 1,888 4 View

How to convert ng/ul of DNA concentration to pmol/ul ?

Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...

21 January 2021 2,671 3 View

Can use Unigenes from RNA sequences for overexpression studies (transformation) without requiring a specific plant genome?

Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...

20 January 2021 5,557 2 View

What is the reason of weight gain in TGA curve of a HDPE polymer sample ?

HDPE samples were aged at higher temperatures in the presence of water and CO2 than the TGA test was performed in Nitrogen? Weight gain is seen in the curve? What could be the possible reason for...

16 January 2021 5,644 2 View

Can BLAST/ search by using known Domain in Transcriptome/Genome data for a gene family?

Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...

15 January 2021 2,293 3 View

Is it necessary to measure the concentration of PCR/Gel purified product for A-tailing and TA cloning?

Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...

12 January 2021 3,272 34 View

Can use the same vector for overexpression and transient expression?

Dear Researchers, I am using pCAMBIA1301/1302 vectors for overexpression study, so can use the same vectors for transient expression? or need to design another vector for transient expression;...

08 January 2021 7,975 2 View

Why negative controls also showing the specific bands of promotor and other regions (GUS, GFP etc.)?

Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...

06 January 2021 8,465 99 View

Can anybody help me out in TRNSYS about short term thermal energy storage used as buffer storage ..?

i am a beginner in trnsys and need help ... can anyone please guide me

20 December 2020 1,040 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

How to compare two groups with only two measurements?

Hiiiii everyone! I have an enquiry on statistical analysis. I was looking for many forum and it's still cannot solve my problem. I want to compare means of two groups of data but only with two...

03 March 2021 8,796 3 View

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

What kind of fluid could I use for a pitfall trap that also does not invalidate molecular testing?

Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...

03 March 2021 5,978 5 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

Do we need to write protocol for a second study of a systematic review that has been registered and published?

I have conducted and published a systematic review and meta-analysis research with the topic related to public health and health pomotion (protocol was registed in PROSPERO). Now we want to...

03 March 2021 8,920 3 View

How to increase a model accuracy ?

dear community, my model is based feature extraction from non stationary signals using discrete Wavelet Transform and then using statistical features then machine learning classifiers in order to...

03 March 2021 6,994 5 View

Chlorinated organic formation in odor control scrubbers using hypochlorite?

I'm involved in a study of odor control technologies for municipal wastewater treatment plant. One of the control options involves a chemical 2-stage (acid/alkaline) packed bed scrubber. The...

03 March 2021 3,661 2 View

Do I need to do linear regression before running mediation analysis using PROCESS MACRO by Hayes ?

I just wanted to check if I need to run a linear regression separately if I am using PROCESS MACRO to run mediation analysis. Thank you.

02 March 2021 4,359 3 View

Waters 2707 HPLC autosampler problem?

I am using a 2707 waters HPLC device. When I try to inject a sample, it says missing plate or rack. I changed the needle and calibrated its position but I still get the same problem. I even get...

02 March 2021 1,408 1 View

Sample dilution for quantitative analysis using ELISA?

If the detection range is in ng/ml but the reference range is in ug/ml for a molecule or protein in serum or plasma .how to dilute and what is the initial volume to be taken for quantitative analysis

02 March 2021 7,670 3 View