I found these primers in Saccharomyces genome database,
Rpb2-930-R: CATTTGCCAATCATTTACGTCGT
Rpb2-335-F: TGTATCCACAAGAAGCACGTTTA
Can I use Rpb2 Saccharomyces primers to identify other fungal species ?
These primers are identical in 70-80% (central part, except the ends) of length to homologous genes of other Eukaryotes. You can get target PCR products with other fungi using lower Ta, but you can get as well many non-specific bands.
following
yes, you can try with these. but ready to get some nonspecific band also.
I have some data about the growth of bacteria under pH stress, data are DO and pH I would like to know what is the most appropriate test to use in this case ? Linear regression or correlation ? in...
10 November 2018 5,002 6 View
is there any protocol describing how to make the measurement stress factors in plants (vegetal physiology)?
02 March 2018 3,988 0 View
When we use SD or SEM mean
01 January 1970 8,342 1 View
After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...
08 August 2024 1,668 3 View
I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...
05 August 2024 9,059 3 View
How to design VN primer to attach with universal reverse primer
05 August 2024 2,116 3 View
TEP presentation caption (The Environmental Project) Re: Why should Washington’s DC, or any country government point of location think of as nowadays of as to being 'tomorrow as to come! if it...
03 August 2024 2,484 1 View
Given that the bacterial genome has over 800 contigs, but its quality metrics are good, with a completeness of 98.55% and a contamination of 0.68% as assessed by CheckM, what specific validation...
01 August 2024 1,514 1 View
It's an end-point PCR protocol. I'm using 1.5% agarose gel with SyBR Safe dye and TBE as a running buffer, visualization on BioRad XR+ system. I was primarily thinking of primer efficiency,...
01 August 2024 4,673 4 View
Hello everyone, I performed a PCR yesterday, and the results showed no bands on the gel. Of course, I probably missed some crucial steps, like adding my samples to the PCR strips themselves, for...
31 July 2024 2,406 6 View
Hello all, I have been trying to follow a 2-stage PCR protocol used to amplify barcodes of a large yeast library, as per Nyugen et al. (2022) -...
30 July 2024 841 2 View
Hello everyone, I am currently looking for tools to recovery viral genomes from bacterial genomes, not metagenomes. However, I have only found tools that are designed for retrieving and studying...
28 July 2024 8,953 1 View
I want to introduce 2 mutations using Agilent's multi-site mutagenesis kit, I designed the primers using their online tool and it gave me 2 sets for primers (1 set for each mutation) so I was...
25 July 2024 6,517 3 View