Abdelmalek Lekired

4 Questions 5 Answers 0 Followers

Questions related from Abdelmalek Lekired

Can i use Rpb2 Saccharomyces primers to identify other fungal species ?

I found these primers in Saccharomyces genome database, Rpb2-930-R: CATTTGCCAATCATTTACGTCGT Rpb2-335-F: TGTATCCACAAGAAGCACGTTTA Can I use Rpb2 Saccharomyces primers to identify other fungal...

07 July 2019 4,351 3 View

Linear Regression or correlation for OD and pH ?

I have some data about the growth of bacteria under pH stress, data are DO and pH I would like to know what is the most appropriate test to use in this case ? Linear regression or correlation ? in...

11 November 2018 4,976 6 View

Is there any protocol describing how to make the measurement stress factors in plants (vegetal physiology)?

is there any protocol describing how to make the measurement stress factors in plants (vegetal physiology)?

03 March 2018 3,967 0 View

“Mean ± SEM” or “Mean (SD)”?

When we use SD or SEM mean

01 January 1970 8,308 1 View