4 Questions 5 Answers 0 Followers
Questions related from Abdelmalek Lekired
I found these primers in Saccharomyces genome database, Rpb2-930-R: CATTTGCCAATCATTTACGTCGT Rpb2-335-F: TGTATCCACAAGAAGCACGTTTA Can I use Rpb2 Saccharomyces primers to identify other fungal...
07 July 2019 4,374 3 View
I have some data about the growth of bacteria under pH stress, data are DO and pH I would like to know what is the most appropriate test to use in this case ? Linear regression or correlation ? in...
11 November 2018 5,000 6 View
is there any protocol describing how to make the measurement stress factors in plants (vegetal physiology)?
03 March 2018 3,987 0 View
When we use SD or SEM mean
01 January 1970 8,341 1 View