When we use SD or SEM mean
Article "Mean ± SEM" or "Mean (SD)"?
I found these primers in Saccharomyces genome database, Rpb2-930-R: CATTTGCCAATCATTTACGTCGT Rpb2-335-F: TGTATCCACAAGAAGCACGTTTA Can I use Rpb2 Saccharomyces primers to identify other fungal...
06 July 2019 4,282 3 View
I have some data about the growth of bacteria under pH stress, data are DO and pH I would like to know what is the most appropriate test to use in this case ? Linear regression or correlation ? in...
10 November 2018 4,898 6 View
is there any protocol describing how to make the measurement stress factors in plants (vegetal physiology)?
02 March 2018 3,918 0 View
What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...
03 March 2021 1,401 3 View
i have problem in preparation of liver tissue with bad cell organelles and how i can adjust osmolarity
03 March 2021 8,890 1 View
Hi, I am after the reference below, my library says it cannot obtain a copy either locally or internationally, any help appreciated! Chris Wang ZM, Heshka S, Wielopolski L, Pi-Sunyer FX, Pierson...
03 March 2021 6,193 1 View
The term miscibility refers to the single-phase state in thermodynamics. I do not mean the compatibility of different components. To determine the miscibility I know several techniques such as...
03 March 2021 4,107 4 View
Need to image mesoporous silica nanoparticles using the TEM. Also, need high resolution TEM images to see the mesoporous structure. Kindly suggest what kind of grids to use. Thanks, Shatadru
02 March 2021 1,787 2 View
Is There Any Feasible Method To Test The Efficiency Of Fluorescent Compounds Other Than UV Spectrometers ? Suggestions Would Be Appreciated !
02 March 2021 5,785 3 View
Hi, I am trying to construct a multi-layer fibril structure from a single layer in PyMol by translating the layer along the fibril axis. For now, I am able to use the Translate command in PyMol...
02 March 2021 4,569 4 View
Hello everyone, I had run a mediation model in SmartPLS using questionnaires that were already validated among my statistical population. A professor who edited my paper -though she is not...
01 March 2021 3,052 3 View
In the sem analysis of CaCO3 nanaoparticles, the morphology images showed spherical shaped particles but the proposed morphology for these type of nanoparticles is trigonal. I prepared the...
01 March 2021 1,960 4 View
I have designed reflectarray element to generate OAM beams at 5.8GHz and feeding it though Horn Antenna on HFSS. After full wave simulation, i am not getting desired results i.e Radiation pattern...
01 March 2021 9,701 5 View
