When we use SD or SEM mean
Article "Mean ± SEM" or "Mean (SD)"?
I found these primers in Saccharomyces genome database, Rpb2-930-R: CATTTGCCAATCATTTACGTCGT Rpb2-335-F: TGTATCCACAAGAAGCACGTTTA Can I use Rpb2 Saccharomyces primers to identify other fungal...
06 July 2019 4,375 3 View
I have some data about the growth of bacteria under pH stress, data are DO and pH I would like to know what is the most appropriate test to use in this case ? Linear regression or correlation ? in...
10 November 2018 5,002 6 View
is there any protocol describing how to make the measurement stress factors in plants (vegetal physiology)?
02 March 2018 3,988 0 View
I have virus (viral hemorrhagic septicemia virus) in suspension and the experiment will not involve cells. What level of TCID50 is preferred?
11 August 2024 3,115 1 View
I am developing a predictive model for a water supply network that involves 20 influencing points. However, I only have historical data for 10 out of these 20 points. I would like to know how to...
10 August 2024 4,005 2 View
Usually, additive manufacturing techniques like SEBM, SLS, and SLM are used for interconnected porous lattice structure generation with sizes of >100–200 micrometers. Can the Fused Deposition...
09 August 2024 7,892 0 View
I need to model an anisotropic material in which the Poisson's ratio ν_12 ≠ ν_21 and so on. Therefore, the elastic compliance matrix wouldn't be a symmetric one. In ANSYS APDL, for TB,ANEL...
09 August 2024 5,048 2 View
I am trying to simulate vehicular loading on an orthotopic steel deck bridge section in ABAQUS software. The red arrow mark in the attached figure indicates the direction in which the vehicle will...
08 August 2024 719 0 View
If we map as a continuous motion an ionising electron (beginning its journey at n=1) in an H atom, a specific hyperbolic spiral appears (see animation). When we solve this spiral formula, we find...
07 August 2024 5,343 2 View
Hello dear colleagues, We have prepared a manuscript on NiTi-based alloys and are seeking a second opinion on our current TEM results. If you are a Ph.D. holder with experience in TEM and have...
07 August 2024 9,563 0 View
Dear fellow researchers, I am currently working on a paper where I need to provide a reliable reference that defines and distinguishes between 3D mesh models and 3D city models. Although I am...
06 August 2024 9,986 2 View
After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...
05 August 2024 9,637 2 View
I am working on Abaqus/Explicit(Quasistatic ) for the deformation of the auxetic structure model. Please explain how the plastic input value should be considered from the true stress-strain curve...
05 August 2024 454 3 View