Is there any protocol describing how to make the measurement stress factors in plants (vegetal physiology)?

03 March 2018 0 4K Report

is there any protocol describing how to make the measurement stress factors in plants (vegetal physiology)?

Badges
Science topic

More Abdelmalek Lekired's questions See All

Can i use Rpb2 Saccharomyces primers to identify other fungal species ?

I found these primers in Saccharomyces genome database, Rpb2-930-R: CATTTGCCAATCATTTACGTCGT Rpb2-335-F: TGTATCCACAAGAAGCACGTTTA Can I use Rpb2 Saccharomyces primers to identify other fungal...

06 July 2019 4,375 3 View

Linear Regression or correlation for OD and pH ?

I have some data about the growth of bacteria under pH stress, data are DO and pH I would like to know what is the most appropriate test to use in this case ? Linear regression or correlation ? in...

10 November 2018 5,002 6 View

“Mean ± SEM” or “Mean (SD)”?

When we use SD or SEM mean

01 January 1970 8,342 1 View

What is the role of oxidative stress in toxin-induced carcinogenesis?

What is the role of oxidative stress in toxin-induced carcinogenesis? I am currently researching the impact of environmental toxins on children's health and would greatly appreciate insights from...

02 August 2024 3,174 1 View

What are the best practices for washing and preparing fruits and vegetables to reduce pesticide residues?

27 July 2024 9,147 4 View

Could GSH level be more in CCL4 rats than negative control rats?

i compare between the antioxidant and oxidative stress level between negative control rats (saline) and CCL4 intoxicated rats. i found the level of GSH and TAC is more in toxic group than normal....

26 July 2024 1,887 0 View

Can we eliminate the stress singularity at the tip of the crack by manipulating the elastic constants?

The aim of the research here is to prevent the propagation of the crack in the fabricated elastic medium with useful applications.

25 July 2024 9,976 3 View

How do nutrient transporters and aquaporins interact under abiotic stress in plants?

"The Correlation between Nutrition and Transport Mechanism under Abiotic Stress in Plants: A Comprehensive Review" by Muhammad Saleem, Jianhua Zhang, Muhammad Qasim, Rashid Iqbal, and Li Song,...

23 July 2024 9,109 0 View

How can alternative crops for augmenting farmers’ income in abiotic stress regions and impact of abiotic environmental stresses on crop quality?

13 July 2024 6,826 5 View

Please give me the scoring system of Academic stress scale developed by Rajendra and Kalikapan?

please give me the scoring system of Academic stress scale developed by Rajendra and Kalikapan?

11 July 2024 2,054 3 View

Is being an Assistant Professor in an university a stressful job?

I would like to know whether being an Assistant Professor in an university a highly stressful job or not?

09 July 2024 1,971 1 View

Can type 2 diabetes be reversed at any age through proper diet and exercise?

Type 2 diabetes can be managed and, in some cases, put into remission through proper diet and exercise, regardless of age. Here are some key points: Weight Management: Achieving and maintaining a...

07 July 2024 8,745 2 View

What is meant by cross-contamination and what causes fruits and vegetables to become contaminated during preparation and storage?

02 July 2024 9,204 0 View