14 September 2022 2 6K Report

Hi,

I am trying to study a splice site mutation using Mini gene assay following the paper attached here. I am trying to synthesize my mini gene using the set of commands mentioned in the paper. But in my output sequence, my mutation is lying before the start codon and hence won't be transcribed. I checked the author's output sequence, their mutation was after the start codon. can anybody please help me in rectifying it.

My commands:

R --slave --vanilla --args -refdirectory D:/Vanya/SplicingVariants_Beta-master/ssfiles -mutfile D:/Vanya/SplicingVariants_Beta-master/mutfile_Vanya.txt -output D:/Vanya/SplicingVariants_Beta-master/Vanya_output.txt -gblocksubmit D:/Vanya/SplicingVariants_Beta-master/Vanya_gBlock_output.txt -ss3 -barcode AA,AT,AG,AC,TA,TT,TG,TC,GA,GT,GG,GC,CA,CT,CG,CC -seq5 TTACGCCAAGTTATTTAGGTGACA -seq3 XXATCTAGATAACTGATCATAATCAGCCATACCACATTTGT -id 6,2 -limitintron 100000 -limit2ndexon 10000 -limit1stexon 10000 -usehg19 D:/Vanya/SplicingVariants_Beta-master/usehg19

Similar questions and discussions