Hello, I'm working on primers from the publication:
Okodo M, Okayama K, Teruya K, Sasagawa T. Uniplex E6/E7 PCR method detecting E6 or E7 genes in 39 human papillomavirus types. J Med Virol. 2018;1–8. https://doi.org/10.1002/jmv.25017
HPV16 gene: E6, Size of the product: 274
Primer F: gacgtgaggtatatgactttgcttt
Primer R: ccccttatattatggaatctttsct
I used to work with annealing temp. 60 degrees, but there was no product. I optimized my PCR process. Positive control CaSki was checked with a gradient to get the best concentration of the product. In the end the annealing temp. was 48 degrees, which makes sense as Tm for primers is ~50 and 52 degrees. Indeed I started to get products, but the concentration was subliminal (capillary electrophoresis). We sequenced the samples (which should have 274 bp but on QIAxcel have always ~300 bp) and they turned out to be complementary to the human genome, 20th chromosome. We took Namalwa cell line DNA isolate as negative control and in 60 degrees was negative but in 48 degrees turned out to be positive with a product ~300 bp. We checked starters and they shouldn't create such products from the human genome.
Can anyone have any explanation? Any suggestions?
Thanks for any help :D
Hi Monika,
the sequences seem to be okay- at least they match the HPV16 reference (the s in the reverse should be an g). The Ta should be around 60°C according my experience. Thus I think there are at least three options:
(i) problems with your CaSki DNA (no target present? thus amplification of the unspecific human fragment at low temperatures)
(ii) the primers do not work well in your PCR system
(iii) the primers are not correctly synthesized (if you had sequenced your PCR product you can easily confirm the correct primer sequence or not)
So you may try exactly the same protocol as in the paper and check the CaSki with some other HPV16 primers (e.g. Häfner et al. Oncogene (2008) 27, 1610–1617)
Best
Norman
Hello Norman Hafner,
thank you very much for your answer. The primers suggestion is just in time, we are considering the possibility of changing them so I'm grateful for your recommendation.
Do you have any idea and could you tell me why:
Previously there were products in 60°C, but in my case and also PhD student there was no product in samples that were firstly positive? (That's why we did the gradient). What is more, the previous PhD student had positive results in 60°C but I have them only in 48°C. In over 90% of cases, we have the same positive result, when and only I have lower temp.
CaSki was present at 60°C, just concentration was lower. But indeed, if there's no viral material, the human sequence might be amplified, but the question is, why not all the samples are false-positive then?
We are using primers from two different companies, but recently using mostly from different than previous PhD student did, that's also an important aspect.
Another question is, how is it possible to get positive results in PCR and nested PCR (I have designed external primers using primer-blast), and then sequencing (after PCR) is saying it's not my product?
Best wishes,
Monika
Hi Monika,
I can only speculate about the reasons for the missing specific amplification.
If I understand correctly not only CaSki but also other samples had positive results (at 60°C) in earlier experiments but presently show the unspecific human product at 48°C, only. Were the earlier results validated by sequencing? If yes, the problem may still be the primers but not because of synthesis problems. Do you have other PCRs running (e.g. a human control fragment) to be sure that all reagents and the PCR cycler are ok?
I would recommend:
(i) use a new set of all reagents
(ii) check the primer stock solution for their concentration and the sequence results of the unspecific product for the presence of (both?) correct primer sequences.
(iii) order a new primer set
(iv) check the PCR cycler settings
Good luck,
Norman
- Badges
- Science method