Dear all,
I am looking for the primer of mitochondrial 16s rrna and 18s rrna in human and mice.
I just find the primer for h 16s rrna and h 18s rrna from a paper.
However, the blast results are not good especially for the h18s (unspecific for 45s and 18s. The 45s is a precursor of 18s, 5.8s and 28s. I am not sure this result is fine).
For human sample, I still can book and try the primer from the paper. But for mice sample, I even cannot find the corresponding gene for the 16s rrna in mice.
Can anyone help me with this?
Thank you in advance.
From a struggling Ph.D. student.
Dear all,
I just find a pair of primer for mouse 16s rrna from a very old paper ( Ibrahim MM, et al., Altered expression of mitochondrial 16S ribosomal RNA in p53-deficient mouse embryos revealed by differential display. Biochim Biophys Acta. 1998 Jul 24;1403(3):254-64),
ACAGCTAGAAACCCCGAAAC
AAGATAAGAGACAGTTGGAC
However, the Blast did not show it matches to the mt-rnr2 or 16s rrna.
I blast it based on the rRNA database. Did I do it correctly?
Thank you.
Using NCBI website based tools and 16SrRNA sequences of human and mouse, primers can be freshly designed also. Good luck !
Kumaraswamy H. H. Thank you so much Kumaraswamy.
Now I get the sequences. Previously I mainly felt confuse about the sequences.
Here is what I found before.
The information of mice mt-rnr2 https://www.ncbi.nlm.nih.gov/gene/17725
The information of human MT-RNR2 https://www.ncbi.nlm.nih.gov/gene/4550
I generally get the sequence of mrna in these kinds of page. However, this time I can not find the detailed sequences of rrna.
So I try to get the complete sequence of mtdna.
(human: https://www.ncbi.nlm.nih.gov/nuccore/NC_012920
mice: https://www.ncbi.nlm.nih.gov/nuccore/NC_005089.1）
Then I get the sequences finally (see the attached files). For sure it will be better if you can help me to confirm it.
And in terms of the blast result for the designed primers, due to the lack of the individual sequence of mt-rnr2 in database, the blast result is always not satisfactory. Because it always matches to the complete sequence of mtDNA. I think this is not a problem.
Best Regards.
- Badges
- Science method