Any recommendations for a primer to isolate the 18s rDNA from the fungi?

More Indra Prasad Velayutham's questions See All

How do proteins get their charge in native gel electrophoresis? Can any one explain in detail?

I'm going to do native page and i just want to know its principle completely.

03 April 2014 9,700 7 View

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

In PRIMER, is it possible to downweight certain taxa in multivariate community datasets to reflect uncertainty around identification??

I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...

03 March 2021 8,066 4 View

New Journal, "Integrative Psychological and Behavioral Science" -- do you not know, and have you not seen, this done before?

Question to you and THEM, the New Journal, "Integrative Psychological and Behavioral Science" -- do you not know, and have you not seen, this done before? There appears to be a core problem for...

02 March 2021 3,024 2 View

PACYC PCR not working after several attempts. Would anyone have any suggestions?

So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...

02 March 2021 1,146 2 View

Does anyone know HRM channel in a 2 plex QIAGEN Rotor- Gene Q qPCR can be used as a separate channel?

I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...

01 March 2021 8,544 1 View

Could you please recommend some good journal that accept very long revie papers (approximately 6000+ words) in neurosurgery, cancer biology ?

01 March 2021 8,087 3 View

Which cell line should we use to perform biological dosimetry experiments?

We are preparing some experiments based on irradiating cells under different conditions in order to evaluate the effects in terms of DNA damage, genetic expression, etc. As our project is...

01 March 2021 3,355 3 View

How to calculate the annealing temperature of a primer pair?

I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...

01 March 2021 360 7 View

Is CD44 degraded in lysosome together with hyaluronan after CD44 mediated endocytosis of hyaluronic acid?

Also when RHAMM binds hyaluronic acid, they get internalized, will RHAMM also be degraded? Or both CD44 and RHAMM will be transferred back to the cell membrane? Asking for breast cancer cell line...

01 March 2021 8,169 2 View

Where to find data on trees in tropical agroforestry?

Hi, I'm looking for data (mainly related to management: growth rate, canopy size, soil and climate preferences, etc.) about tropical trees used in tropical agroforestry. Have you ever heard about...

28 February 2021 7,356 8 View

Nandagopal Murugan

The pcr primers were nu-ssu-0817-5′ (ttagcatggaataatrraatagga), nu-ssu-1196-3′ (tctggacctggtgagtttcc), and nu-ssu-1536-3′ (attgcaatgcyctatcccca). Use this article for the primer sequence

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC92308/pdf/am004356.pdf

Jimena Ortiz

which of them is the best primer for determining fungi diversity by SSCP?