Any recommendations for a primer to isolate the 18s rDNA from the fungi?

More Indra Prasad Velayutham's questions See All

How do proteins get their charge in native gel electrophoresis? Can any one explain in detail?

I'm going to do native page and i just want to know its principle completely.

03 April 2014 9,802 7 View

Can I base on reverse DNA sequences to perform alignment, convert to amino acids and GenBank submission?

I have reverse sequences (AB1 format), can I base on reverse DNA sequences to perform nucleotide alignment, convert nucleotides to amino acids and deposit the sequence in GenBank database?

11 August 2024 5,138 1 View

I can't see the ssDNA band after performing asymmetric PCR. Is there any way to do this?

After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...

08 August 2024 1,668 3 View

Does crude extraction using NaOH and Tris work well with Fungi?

I'm trying to find a DNA extraction method for fungi that does not require equipment and heating. Is there anyone who can suggest an alternative option? Thank you

08 August 2024 4,733 2 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

Why after performing site directed mutagenesis ,I don't see any colony after transformation?

I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...

05 August 2024 9,059 3 View

Anyone having idea about VN primer for miRNA primer design ?

How to design VN primer to attach with universal reverse primer

05 August 2024 2,116 3 View

The Curse of Evolution and Complexity?

Brain and body mass together are positively correlated with lifespan (Hofman 1993). The duration of neural development is one of the best predictors of brain size, and conception is the best...

05 August 2024 6,247 3 View

Do you have good tips for seaweed tissue preservation in the field for post RNA extraction?

I will be with my students collecting seaweed samples in a marine farm and later we will process this tissue for RNA isolation and further sequencing. Does anyone have tips on how to collect the...

04 August 2024 501 2 View

How to isolate lymphocytes from mouse spleen?

I have tried several times to isolate lymphocytes from mouse spleen, but all attempts have been unsuccessful. I tried most available protocols. I used different dissociation media (HBSS with Ca...

04 August 2024 9,913 7 View

Does anyone have issues using Prepman Ultra reagent for MicroSeq ID bacterial, fungal and yeast sample preparation?

I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...

01 August 2024 2,079 0 View

Nandagopal Murugan

The pcr primers were nu-ssu-0817-5′ (ttagcatggaataatrraatagga), nu-ssu-1196-3′ (tctggacctggtgagtttcc), and nu-ssu-1536-3′ (attgcaatgcyctatcccca). Use this article for the primer sequence

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC92308/pdf/am004356.pdf

Jimena Ortiz

which of them is the best primer for determining fungi diversity by SSCP?