hello i am doing a research on microrna and i used the stem loop qRT-PCR for quantification of microrna. i designed the RT primer following the guidelines in chen et al paper. for the RT-PCR i used the following condition:
16°C 30min
42°C 30min
70°C 15min
4°C ∞
for the qPCR i used sybr green instead of taq because of cost and the condition were:
95°C 10min
95°C 15s
60°C 1min
72°C 10s
for spike control i got good melting peaks but for microrna i got awkward melting peaks.
can someone help me to solve this problem?
thanks
you can use sybr green for qRTPCR of miRNA. i guess u need to look a the annealing temperature as well as extension tym. it also depends upon wht kind of qPCR protocol you are folowing i mean..is it two ste or three step? for ease u can go for 3 step pCR reation where u need to mimic normal RTPCR cnditionsu used for amplifying ur miRNA. u problem for multiple and aberrant Tm peaks would be resolved
for qpcr i used sybr gree dye.for qpcr condition i did as follow:
95°C 10min
(95°C 15s
60°C 1min
72°C 10s)*40 cycles
which is three steps pcr
thanks for your answer
Check the purity and quality of your RNA. If remnants of phenol are in your sample, or mRNA degradation products, miRNA PCRs can give these strange melting curves. You don't find them in your spike controls as they are probably derived from a different species. Good luck!
Hi,
Adham,
The PCR steps and time looks fine. Since there are multiple peaks, you have problems with your primer, for which sample are you getting good melt curve. You can either standardize the concentration of primer or redesign a new primer.
Regards,
Prasad.
Dear Adham Sabri, did you used one stemmloop primer (or multiple ) in RT rxn?
i had the same issue, so i was thinking about it, maybe TOTAL RNA has multiple variants of one microRNA, pre, pri and mature microRNAs, i made electrophoresis and got multiple bands, i am changes multiples parameters hopefully works, did you solve your issue of multiple melting peaks??
Dear Najib Abdellaoui , I am also planning for stemloop rt analysis of microRNA. Can you provide me the stem loop primer sequence for cel-mir-39-3p . I designed rest of my stemloop primer using Chen et al paper.
Thanks
Dear Kaur, I designed primer for cel-mir-39-3p. However, it didn't work well while doing the qPCR. The cel-mir-39-3p sequence is UCACCGGGUGUAAAUCAGCUUG and you can design the stemloop primer.
- Badges
- Science topic