Hello everyone.
I was trying to clone a region of ULBP1 and MICA gene from human PBMC cDNA preparation. I had setup first PCR and even though I got the amplification, both of them are at wrong size (expected size MICA = 874bp while expected size ULBP1 =.594bp). I checked my primers annealing to gDNA and I doubt that this amplification is actually from gDNA. It is known to us that cDNA that I have used has gDNA contamination.
So, is it really the amplification from gDNA and how can it be avoided ?
Primer Sequences :
ULBP1 FP -> cggGGTACCGGATGGGTCGACACACACTGTCTTTGC
ULBP1 RP -> AATAGCGGCCGCGCCTGGGGCCAGAGAGGGTGGTTTTG
MICA FP -> aataGGTACCGAGCCCCACAGTCTTCGTTATAACCTC
MICA RP -> aatagcggccgcCCAATGACTCTGAAGCACCAGCACTTTC
Hello
Do you design your primers according to the exon-exon junction primers?
These primers are specific for the amplification of cDNA, because they can only bind to the exon sequences. Therefore, these primers cannot bind to genomic DNA which contains introns between exon-exon junctions. Therefor, if potentially you have gDNA contamination, it would be possible to reduce your false positive bands due to the contamination by several orders.
You amplified the gDNA since the amplicon size makes sense and your primers are not cDNA specifc. You can sequence your PCR fragment to verify to know for sure.
I believe you're trying to amplify parts of NM_025218.4, but your forward primer can bind to gDNA since it has 18bp perfect overlap with the 2nd exon. Your reverse primer can also potentially bind to gDNA since it only has 1 mismatch GCCTGGGGCCAGAGAGGGTGGTT "T" TG with the gDNA. You have to redesign your primer so each primer covers two exons more evenly.
Honestly, the sequencing of your fragments would be a waste of time and money. Whenever you suspect a contamination, the best thing to do is to make the cDNA again (for human genes you can use any human cell lines like HEK, HeLA, etc) and run the PCR again.
Thank you Mahsa Saliani , Nancy Zenan Li , and Alessandro Palma for your replies. I think that using atleast one exon-exon junction primer for 1st PCR to pull the cDNA fragment and then using current primers can be a good strategy, if nothing else works. For the time being, I am trying to amplify with better cDNA preps from HEK/HeLa cell lines. Nancy Zenan Li Sequencing here takes atleast 1 week of time so I am not considering it as of now.
You are welcome.
The other strategy to reduce the possibility of gDNA contamination is using from DNase treatment. After RNA extraction, you could use from DNase treatment kits, which degrade any potential DNA contamination.
Hello everybody. I combined the two approaches : 1) Preparing fresh RNA with Trizol method for minimal contamination of gDNA, 2) Using exon-exon junction reverse primer with old forward primer.
Eventually, I got correct size amplification with almost no wrong size amplifications. Thank you everyone for your help.
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Molecular Methods
- Cloning