hi

try to use software that will show you the bias (homo and heater dimers, loops and hairpin...) to avoid those troubles in primer design. Primer3 doesn't allow this, try Oligo7 if you can purchase a licence.

fred

Hi Frederic

Thanks for your kind information. However my main query was on a desirable hairpin at the cost of the self dimer towards a desired goal. In case palinderomic sequences are purposefully built into the oligo to avoid self dimer but not the hairpin which is required, which case will be more pronounced during  the thermal cycling?

Thanks 

not easy...

the goal of the thermal cycling is to align 3D structured molecules. to reach your goal you will have to play with time, Tm and MgCl2.

fred

Yeah, could be... 

thanks again ☺

It will depend on the sequence of the oligos. Use a software to evaluate this.

Plus, this is also affected by Tm and MgCl2 concentration

It depends on the energy difference of the different conformations and what concentrations you have.  So salt, T, [c], structures are all determining what forms is predominant

Hi Satpal,

You can use the following online software to assess the probability of hairpin formation of your primer sequences and their stability at the annealing temperature of the PCR. You can also check the stability of the possible primer dimers and compare the relative stability of the haripins and the dimers to assess which structure will predominate:

http://unafold.rna.albany.edu/?q=mfold/dna-folding-form

My hypothesis is that if the primer hairpin structure is strong enough, they will indeed prevent formation of dimers. I would recommend you to consult a 1997 publication on HANDS PCR (Brownie J et al) where 5' tails were added to the end of the amplimers to generate hairpin shaped structures for the primer dimers themselves, which prevented any further amplification of the dimers.

In your particular case, I think the key point here is the stability of your primer hairpins during the annealing temperature. If your primers do form a hairpin, their stability will depend on the Tm of the stem portion of the hairpin in case it's a perfect pan handle structure. If this structure is indeed stable at your annealing temp (stem Tm > or = annealing temp) then two things can happen depending on the primer-target Tm:

1. The hairpin stem Tm < the primer-target hybrid Tm: Then these primers can actually act as very good SNP discriminatory primers and lead to very specific amplification because the structural constraints of the hairpin will prevent the primer to bind to non-specific sequences (they will act more like molecular beacons). Very specific amplicons will be obtained and very less primer dimers.

2. The hairpin stem Tm > the primer-target hybrid Tm: This implies a very strong hairpin and the primer will prefer to remain in its hairpin conformation at the annealing temp. So no amplification will occur even in presence of a specific template sequence.

If the haripin stem Tm is lower than the annealing temp, then your PCR should work as desired and the hairpins might prevent formation of primer dimers which I think you already pointed out, but the PCR might be less specific if you are dealing with highly GC rich sequences. For further information on how hairpin primers can be efficiently used as SNP discriminatory primers, please consult the following publications

PMID: 15004082 and PMID: 15242954

Best regards and good luck with your research

Soumitesh

@Iker, @Markus and @Soumitesh

                                                             thanks for your inputs and the guiding info.

in particular @Soumitesh, your detailed and insightful comments and further information would be greatly helpful in my specific case, though i intend to use this strategy in a non-SNP based experiment where hairpins are required to abrogate primer dimers (self dimer to be more precise).

Also, given below is my test oligo seq to verify the utility of any idea targeted at achieving the desired end goal. Note that palinderomic seqs (RE sites CTCGAG) have been introduced in the body of the oligo apart from 5' and 3' seq complementarity to allow hairpin formation. 

GCTCTGACCTCGAGGGCACACTCGAGCTCTCTCTAGAGCT

Further comments/inputs are welcome...

best regards

Satpal Singh

don't know if it helps but you'll find in the attached file the loops in your sequence.

fred

hi Frederic

thanks for this effort....   good job :)

you're welcome