I am working on trinucleotide repeat and observed weird background sequence after my sequencing product. There are reverse sequence signal after both forward and reverse sequence. For example, if my desired forward sequencing product is AAACAGCAG , my observed forward sequencing result is AAACAGCAGCTGCTGTTT , while reversed sequencing is CTGCTGTTTCTGCTGTTT.
This observation only happens after I added M13 sequence to my original primer design. Although the background signal is low and did not interfere my sequencing results, I was wonder what cause such background and anything I can do to optimize my protocol. My new forward primer was predicted to have self-dimer as attached. Could it be the cause? I would be extremely grateful if someone can answer me.
what clean up methode of thepcr product are you using before running the sequencing reaction. ....commercial by the sequencing company or exo-sap?
Can you post one of the sequence files ( *.abi files) with the odd result please?
Paul Rutland I’m using Exosap. I performed Sanger sequencing with other genes, only this gene (SCA17) have this problem. Here are the abi files attached. The background sequence can be seen if you enlarge the signal after the sequence product ends. C330 should be heterozygous while C334 is homozygous sample.
hello Karen Karen Wong , thank you for the files which I will check later today.
There is one important thing that you should know about exosap. The exo only destroys single stranded dna . The problem here is that your primer has a strong region of homology with itself so forms a loop with a double stranded neck to the loop. So exo trims the ends (SSDNA) but leaves the loop intact. This means that after exosap you still have 1 shortened primer so when you add the sequencing primer one tube has 2 primers ( R and shortened F) but the other tube has for instance ( F and shortened F) . If the 3' end of the F primer is intact then F and shortened F will still give the same sequence while R and shortened F will give 2 sequences. I used exosap and think it is excellent but occasionally it fails and your problem sounds like a partial fail leading to a high background which is actually a good reverse sequence. I am sure that any other primer removal method will work well for this primer pair and this is not a template dna problem. You can test this answer by doing exosap and then without adding any sequencing primer run the sequencing reaction and you should get a good quality sequence so long as one of your primers has been degraded by the exo
Paul Rutland Thank you so much Paul! I’m still confused since shortened F primer should produce forward sequence, but here reverse sequence is observed. Besides, since the reverse sequence signal is shown after my desired product, which means its length is longer with higher bp..? 🤔
Karen Wong I did not know which primer was affected so was writing generally and looking at the sequences still leaves questions like why c330 has 150 well sequenced bases and a mess while c334 has 250 good bases. Could you send me a text or word file of the amplimer sequence please as it might help having a good reference for sequence alignment
thank you
paul
Have you checked the band size & intensity on an agarose gel before sending for Sanger? Do you see just 1 bright band?
If the bands are faint, then that can be one reason the sequence is useful for only a short stretch of bases.
Looking at the c330 file, you have a mixture of at least 3 different PCR amplicons.
Katie A S Burnette thank you for your reply. Sorry that I missed your message >< Here is the gel photo, there was no other band observed, and the product size was the expected size of ~281.
Paul Rutland Sorry Paul for my late reply since I missed your message. I attached a word doc of my primer design and expected sequence. Thank you so much for your help!
Hi Karen I have attached a file in anticipation of letter spacing looking wrong in this answer
Thank you for the reference seq Karen,
Clearly we ignore the low intensity signal that the basecaller is trying to call but is really background contamination and electronic noise and only look at the strong sequence.
Seq Eo3has a complex structure so the sequence of the reference is CAGCAGCAACAGCAACAGCAGCAGCAGC BUT THE SEQUENCED dna is
CAGCAGCA--- GCAACAGCA-- A- CAGCAG.
The average signal strength is only 500 but this is usually ok for a good sequence
Sample C03 in the triplet gives sequences of
CAGCAGCAacag (cg)(ca)(ca)(cg) etc . Its mean signal strength is 700 which is ok so we have an indel following the triplet repeat and cloning would make the nature of the indel clear.
Sample C06 has a signal strength of 1000 so is very goodalthough many sequences of CAG are reporting as caR which can be a symptom of a failing capillary on the sequencer but we do get the sequence becoming 2 sequences as
GACGACGACG(AG)(CG)(AG)(aa)(cc)(ac)(Ag)9AC) so there is an indel in your sample sequence.
Sample E06 has a good signal strength of 800 and is homozygous for a sequence that differs from your reference as below
REFERENCE
CAGCAGCAACAGCAACAGCAGCAGC IS SEQUENCED AS
CAGCAGCA---GCAACAGCA—GCA—A-C AND IS HOMOZYGOES FOR THIS CHANGE
Hope this helps
Paul
Paul Rutland Thank you Paul, so maybe I can ignore the background sequence and keep my current protocol?
You can ignore the very weak signals before and after the sequence of the pcr product but your sample cohort does seem to be polymorphic in a triplet repeat region and the existance of 2 overlapping sequences of good signal strength cannot be ignored as it is symptmatic of an indel or 2 similar but different sequences on different chromosomes but the sequencing looks good so the current protocol looks good
- Badges
- Science method