1.FIP and BIP

2. F3 and B3

3. dNTPs

4. Bst Polymerase (substantial section)

5. MgCl2

6. Betaine

7. Cradle

8. H2O

There is no request furthermore of reagents. I influence the Light to ace blend in ice and include the Bst polymerase toward the end. Ensure you include same measure of layout DNA to get reliable outcome. Aliquot all your Light reagent in little volumes and store it at - 20. Rehashed solidify defrosting can decrease the productivity of chemical.

Did you get false positive outcome? In the event that yes, one of the conceivable explanation behind your concern is defilement. Opened up Light item is exceptionally unpredictable and simple to get defiled.

A portion of the safety measures I take to limit tainting:

1. Utilize isolate pipettors to blend Light reagents and load opened up item into agarose gel

2. Try not to open the tube (after response) inside the laminar stream hood/bio security bureau .

3. Utilize isolate working spot to influence Light to ace blend and stacking intensified Light item into gel.

regards

Thank you for your answer.

I don't have any positive result whatsoever. True or false I don't see any amplification. I do everything on ice, and add polymerase at the end, just before the DNA.

Ayça... This person "Hassan Nima" is a fraud. Check out the link

https://www.researchgate.net/post/LAMP_reaction_problem-can_anyone_help

The first you check sequences primer. Then if the neuclotide is correct. You should PCR for outer primer with temp gradient from standard sample. When temperature is set up you could lamp from samples. All of reagent and enzyme must be don't expire.

I agree with Maryam. Remember, that the publisher can make mistake in presenting sequences of the primers (i.e. type errors), so you need to check the sequences yourself whether they make sense!

Which Bst polymerase do you use? I have used Bst 3.0 polymerase. I did not get good result with Bst 2.0 polymerase. Usually, if LAMP has worked, you can observe increased turbidity in the reaction vial.

Check magnesium concentration. Usually, you have to add extra MgSO4 in addition to the commercial amplification buffer.

Remember to use RNAse-free water if you use ribonucleotides.

Good luck with your assay. To me it sounds like you need to add a bit more Mg and make sure you use right enzyme and right sequences.

Remember that once your assay will start working, you will get false positive signals. This happens if you open tubes - you will spread amplicons from previous reactions into the lab environment when you do electrophoresis. So another problem will appear after this one will be solved.

Ayça N. Mogol l did you solve the problem? I encountered the no-amplification problem today as well. I was running LAMP for the very first time. The problem in my case was the reaction setup on the thermal cycler. I had set up the reaction at 68*C at 60 minutes for one cycle instead of 60 x 1 minute cycles.

Antonio S Minero I'm sorry to bother you a bit. I got the same problem as you mentioned. I do with WarmStart® LAMP Kit (DNA & RNA) NEB #B1700 and I set up the reaction at 65oC - 60 minutes/ 85oC - 5 minutes. Below is my period-making LAMP:

1st: no amplification ->2nd: successful (same protocol) -> 3rd: no amplification -> 4th: false-positive signals -> 5th: successful (same protocol) -> 6th: false-positive signals.

I use LAMP to detect Pseudomonas aegruginosa and the primer I use is

F3: CAAGCGCAAGATAGTCGCC (19bp)

B3: TCCGCTTGAACAGGCTGGTG (20bp)

FIP: GAAGATATCCGGCTGGTTGCTTTTCAAGAGGGAATGCCGCAGT (43bp)

BIP: AACGGATCATCGGCATCCTGGTTTTCATCGCCGTCCACAGGTAGA (45 bp)

Can you give me some advice? :((((

My email is [email protected]

Thank youuuuu