I tried extracting DNA from an unknown environmental fungal isolate using Qiagen DNeasy extraction kit. However, I was unable to extract DNA in the first attempt. Then I tried increasing the incubation time but still was unable to extract the DNA. Then in my third attempt I homogenized the fungal tissue using mortar & pestle followed by Qiagen Blood & Tissue kit procedural steps and was able extract the DNA with following Nanodrop readings;
Concentration - 46.7 ng/µL
A260/A280 - 1.86
A260/A230 - 1.11
A260 - 0.93
A280 - 0.5
Factor - 50.00
Baseline correction: 340 nm, 0.11 Absorbance
However, upon PCR amplification using the extracted DNA against ITS-1 and ITS-4 primers did not yield any amplification but the amplification was observed with the positive control. Further, I tried setting up PCR with diluted DNA (1:5, 1:10, 1:20) and also with increased quantity of DNA; adding up to 4 µL of template DNA to a 10µL reaction volume. But none of the reactions yielded any amplification.
Can anyone help me understand why the DNA is not getting amplified?
Thanks & Regards
Dr T Yugendran
Guanidine salts from the purification are the most likely cause of the low 260/230 ratio so you may want to try re precipitating the dna with a glycogen or linear acrylamide co precipitant as you do not have much dna. As this is an unknown fugus do you know that your positive control is actually a control. Possibly the primers do not perfectly match your species of fungus so pcr cannot work. You might try lowering the annealing temperature to try to get a dirty amplimer then try to improve the amplification once you have a positive result
Hi,
extraction of fungal DNA is not easy as it requires a good lysis of these cells.It is possible that your have only bacterial DNA present in the sample. In case you still have sample I would recommedn to test the DNeasy Power Soil pro as it is ideal for fungal and bacterial DNA extration from environmental samples.
I would recommend to test the extracted DNA with a kit suitable to quantify fungal DNA ( I am currenty running a field test for such a kit).
Let me know if this helps
Sven
Hi, there are n factors why you are not amplifying, you do not always get the real values using the nanodrop, in order to help you optimally I would like to contact you by e-mail, if it is of interest. The e-mail where we can continue the conversation is: [email protected]
Best regards
Antero
Paul Rutland I will definitely try setting up a gradient PCR using the extracted DNA. Thanks for your suggestion.
But, I have one more query. The positive control is the known ATCC culture of Aspergillus brasieliensis and its extracted DNA got amplified when subjected to PCR using ITS-1 and ITS-4 primers. However, I am unable to amplify the the extracted DNA from unknown fungal culture using the same primers. What could be reason for the inability to amplify the extracted DNA?
When you do the gradient pcr deliberately use too much Mg ( 3mM) as the contaminants may be taking up MG and not leaving enough for the Taq. It may be that your unknown fungus is not related to A Bras and has a different sequence at the primer positions ( only one base at the primer 3' end is enough to spoil a pcr) so the primer pair does not anneal correctly and amplification may not happen. New primers might help but initially run the primers at a low temperature to try to get round the possible mismatch problem and while things are not working use 35 cycles of pcr in case it is just working but not very efficiently. Once you have a positive result you can worry about cleaning up the amplimer.
Hi Yugendan
As you have high quality DNA a very quick and easy test would be to spike this DNA in your eluates. This would show you if yoi bnhave PCR inhibition or just no fungal DNA in your eluates. Regarding inhibitor resistance I could recommend you some kits if you like as I was working on this topic extensively during the last 2 years
Sven
Sven Reister Thanks for your suggestion. I will certainly try setting up a PCR with the spiked eluate.
I also set up a PCR using 16S primers for the extracted DNA eluate and did not yield any amplification. So I feel the eluate does not have any DNA of bacterial origin.
Could you give me any further inputs?
It would be a good idea to compare as many fungal ITS1 and ITS4 sequences as possible and find 2 regions of complete homology to design your primers to make sure that they amplify as many species as possible but if your primers still look well designed then it is still possible that the quality of your dna is still poor and that is why the pcr is not working. Perhaps we need a primer set from another gene just as a test of the quality of the dna
I agree with Paul. Sometimes an annealing site is disrupted by an Class I intron in the SSU or LSU. Try a few more primer pairs in rDNA region.
Paul Rutland The primer sequence that I have employed is appended below,
ITS1 - TCCGTAGGTGAACCTGCGG
ITS4 - TCCTCCGCTTATTGATATGC
It is a universal primer and using this primer we have amplified and sequenced of a vast set of fungal species across multiple genus. Do you still feel primer coverage is the issue over here?
thank you Jugendran. I have Blasted the primers and they are excellent common sequence primers to very many funghi species. That does not absolutely rule out a novel sequence but it does look like the problem is the type/quality of your dna .
Using a kit such as Sven Reister suggests is looking like a strong idea
Hi,
depending on our transportation partners I can check if I could send you such a kit and also propose you a mastemrix which is highly resistant agains inhibitors also candidates which complex magnesium etc. In case it is interesting for you we can proceed discussing htis via email.
Best Sven
- Badges
- Science method