Dear Yulia,

I think you should give more details e.g the target sequence you are amplifying, the primer you used, the sequencing result and the primers used for sequencing. Perhaps these details need to be taking into consideration. Usually if you have selected your forward and reverse primers far a way from your target sequence , you can have a PCR product to have more base pairs, and if you sequence the PCR product you can actually see  that you have the correct sequence.

You mean after sequencing the result is a 158 bp fragment? 

Are you using agarose gel for electrophoresis?

Have you loaded any other PCR product with known size beside your desired one in the same gel? it can give you an idea...

providing an image of your gel can be helpful... 

How do you sequence your resulting product? From PCR or do you subclone it? If you are using one primer to sequence your product and that primer anneals 42bp from the end, then you will get he exact sequence. If you subclone the product and sequence using primers for whatever plasmid you are using, you might be able to identify those extra 42 bp

Thank you all for the answers.

1. I am doing a PCR on beta tubulin from worm tissue Ascaris lumbricoides and Trichuris trichiura  

2. I use primers from a journal that also did PCR on those two species. 

for A. lumbricoides 

primer forward : agagccacagttggtttagatacg

primer reverse : AGGGTCCTGAAGCAGATGTC

for T.trichiura 

primer forward : CGCCTTTTTAGGTTTCAGATACA

primer reverse : GTCTCCGTAAGTTGGTGTTGTTAA

3. for PCR I used Kit PCR Kapa Taq Extra HotStart ReadyMix

the annealing temperature used is 54,3

4. I used PCR product in gel agarose 1,5% in TAE 1x and used SYBRgreen as dye.

5. my electrophoresis result :

Ascaris : around 200bp

Trichuris : around 200bp

when the electrophoresis was done in other place :

Ascaris : around 200bp

Trichuris : around 160bp

the target for A. lumbricoides is 158bp and for T. trichiura is 163bp.

But when I sequence the PCR product I got the right result according to the BLAST on NCBI

Dear Yulia,

I think as long as your PCR products, when sequenced give the correct results I would not worry. As Stafano correctly points out the discrepancy in size, on a gel, could be due to the retardation due to Sybr-Green and also the quantity loaded into the well can affect its mobility in the gel. 

I agree with Stefano. I have used Gel Red for several years.