@Ye-Han-32

Ye Han

1 Questions 1 Answers 0 Followers

Questions related from Ye Han

Why didn't my Dz13 reduce the expression of c-jun?

Dz13 sequence:C*G*GGAGGAAGGCTAGCTACAACGAGAGGCGT*T*G prime：TGACTGCAAAGATGGAAACG CAGGGTCATGCTCTGTTTCA *epresents a phosphorothioate. Transfection method: Transfect 3 uL Lipo3000 and 2 ug DNAzyme...

24 October 2024 7,760 1 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close