03 January 2022 1 3K Report

*Please suggest a few free Nutrition journals (without publication fees /article processing charges) where I might submit my review paper for publication.

More Nadeem Rais's questions See All
How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

QSPR model is not fit for or it does not deliberate best answers. How we can improve it?

The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.

29 August 2023 7,764 2 View

What the difference exists between the QSPR analysis by using 2D and 3D model of drugs structures?

Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?

27 August 2023 552 2 View

How to establish a Mathematical Model on "Transfer of heat in human body organs"?

I'm looking for a mathematical model for transfer of heat in human body organs especially (eye, heart, brain and lungs). How is the behavior of heat transfer at normal and extreme levels

12 July 2023 4,888 2 View

Similar questions and discussions
Which Scopus Journal provides the most affordable fees?

"PUBLISHING IN A SCOPUS JOURNAL" Researchers are now at a cross road. The critical need to publish in a Scopus or ISI, etc journal is ever vital. Journal Publication fees must be submitted....

10 August 2024 8,621 1 View

Seeking Advice on Viability and Execution of Undergraduate Thesis Topic?

Hello everyone, I am currently developing a thesis proposal and would appreciate your input on its viability and how to effectively carry it out. My proposed topic is: "Does the perceived threat...

10 August 2024 8,992 0 View

Who will be moral responsible for the death of thousands of people in the event of an earthquake?

Who will bear moral responsibility for the deaths of thousands of people in the event of an earthquake? Weeks and months remain before the onset of strong earthquakes that bring death to...

08 August 2024 6,134 12 View

Hello Everyone ! I'm looking for a good journal to publish my manuscript with low publication cost?

I am Looking for a Science Journal with good impact factor and low publication cost to publish a review paper. Your suggestions would be appreciated.

06 August 2024 6,796 3 View

Are there any instruments for studying time similar to the way it is in space?

There are a huge number of methods for studying objects in space, according to the senses (and not only). Mechanical, thermal, optical, acoustic, electrical, magnetic, based on particle beams,...

06 August 2024 7,102 0 View

Is Galaxy.org good to use for research for analyzing data and for publication?

Hello all, I wanted to know, can I use galaxy (USA, Europe or Australia) platform for analyzing the shotgun data, and can it be used for publication purpose as well? Thanks :)

06 August 2024 6,610 4 View

How to convert a privately loaded document into a public document?

I attempted to make a privately uploaded text public but a window appeared that said an error occurred. There was no explanation provided as to why there was an error or what might be done to...

05 August 2024 8,025 7 View

In the case of a wound l recurrence after radical breast cancer and sentinel lymph node biopsy. Are the sentinel lymph node procedure recommended?

In the case of a wound l recurrence after radical breast cancer and sentinel lymph node biopsy. Are the sentinel lymph node procedure recommended? If no axillary lymph node dissection was not...

05 August 2024 8,056 1 View

Regarding a model for simulating battery charge and discharge, what do you consider to be high fidelity?

Regarding a model for simulating battery charge and discharge, what do you consider to be high fidelity? What is the acceptable percentage of error (regardless of the metric)? Could you suggest...

03 August 2024 5,358 0 View

Interested in a SCOPUS collaboration?

Hi RG family. My team and I are working on some SCOPUS publications and we need co-authors who are willing and capable of undertaking both qualitative and quantitative-based studies. The scope...

02 August 2024 7,843 0 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close