The primers are very poor (see attached files). An analysis on PrimerBLast suggests your 3' end is mismatched on the forward primer, which explains your lack of amplification.

Products on target templates

>CP007755.1 Bifidobacterium animalis strain RH, complete genome

product length = 936

Forward primer 1 ACCATGGTGGATACTACGGCACACGGA 27

Template 1275672 .G............C...........C 1275698

Reverse primer 1 CGCACCCATTGGGAACACTCGAGTGCT 27

Template 1276607 ..................C........ 1276581

If possible, please tell me the reaction conditions you are using for amplification means concentration of components or size of amplicons and other cycling conditions. Probably then only I can help you.

The primers are very poor (see attached files). An analysis on PrimerBLast suggests your 3' end is mismatched on the forward primer, which explains your lack of amplification.

Products on target templates

>CP007755.1 Bifidobacterium animalis strain RH, complete genome

product length = 936

Forward primer 1 ACCATGGTGGATACTACGGCACACGGA 27

Template 1275672 .G............C...........C 1275698

Reverse primer 1 CGCACCCATTGGGAACACTCGAGTGCT 27

Template 1276607 ..................C........ 1276581

I suggest you to do PCR with template titration n also you can try adding 2-5% of DMSO to your reaction which may give u clear and specific PCR product.

i agree use Ethylene glycol and 1,2-propanediol for gc rich see reference 

Meeta, download AmplifX and do a PCR on your laptop using your primers, then see if it amplifies to be sure your primer set is working. If it works, then check the concentration of your primer, be sure the stock primer is diluted eg 100pmol, 50pmol accordingly. Next, alter your annealing temperature and amplify, then watch out and see, it should work all things being equal.  

Thanks for al of yur suggestion... i'll check out and come to yu ppl

Hello Stephen Andrew Bustin

Wat yur suggesting may be true but wen i worked with different  downstream primer ATAACTTCCGGTAGAGCCTCCATATGG it worked out @ 40 0C annealing  along with pfu polymerase but for the other primer which i sent previously with tat its not working.. can yu suggest for this

Hello Anyebe Onoja

i downloaded AmplifX software and run  i'm not getting  results.is it'll open with new file r wat

Suloka, I have run your primers through Beacon Designer, which I thinks is the best primer design programme on the market, and your reverse primer has a melting temperature of 69.4ºC, suggesting an annealing temperature of around 64ºC. This compares to a meting temperature of 78.5 for the previous reverse primer. I have designed a couple of primers into the same region you have selected:

F: CAATGTCGGAATGCTGTG

R: GAATGCGGGTTTCAATGG

They are attached with fold amplicon structure (good, nom secondary structure in primer target sites) and F+F, R+R and F+R secondary structure analyses (there is none). Optimal Ta=55ºC. Those should work well. PrimerBlast also suggests that the primers are specific for Bifidobacterium

Stephen, actually i constructed reverse primers by introducing silent mutation @ the wobble site by that i can get Xho 1 site. for digestion of that

Anad is i can able to amplify 2.2 kb frrgment @a time

Hello,

as Stephen pointed out, the most critical problem is your fwd primer, where a mismatch occurs at the very 3' end. I don't know why you put the mismatch there, however mismatches at the 3' end dramatically decrease the efficiency of every PCR reactions. If you really need that mismatch, you should put it at the 5'.

I hav consturcted tat for b.animalis lactis its exactly bind to tat at 3' end

Hello every one i designed my primers for the following sequence please now suggest me something

ATGGTGGATACCACGGCACACGGCACGGACCACTACAATCTCATTGACGGCCGCTACCGCATTGTGCGCAAGATCGCGGATGGCGGCATGGCCACGGTGTACCAGACCGTCGACGAAAGGCTCGGGCGCAATGTGGCGGTCAAAATCATGCACATGCAGCTGGCCCAGGGCCCCCACCGCGAGCAGTTCATCGAGCGCTTCCGACGGGAGGCCAAATCCGCGGCAGCAATAGCCAATCCGCATGTGGTGCAGGTGTACGACACCGGTGAGACGAATGGCTCGTACTATCTGGTCATGGAGTATGTGCACGGCGTGAATCTGCGTAGTCAGATGCAGACGCACACCACGTTCTCGGTGCGCGACACCCTGCGCATCGTCGGCGAGACATTGAACGGACTTGCCGCCGCCCACGAGATCGGCGTCGTACACCGCGACATCAAGCCGGAGAACATTCTGATCAACGACCGCGGTCATGTGGAGATCACCGATTTCGGCCTAGCCAAGGCCGCCTCGCAGGCCACGCTCTCCTCCACCGGGATGCTGCTTGGCACAGCGGCCTATCTCGCCCCGGAGATGATCGAAAACAACCAGGCCACTCCT

CAGGGCGACTGCTATTCCGTGGGCATCATGGCATGGGAGCTGCTGGCGGGGAGGGTGCCGTTCCAGTCAGACAATCCGGTGACGATGGTGTTCAGGCACGTCAACGAGAACATCCCCTCCATAGGAACGGTGTGCTACGGCATCGACCCCCGGGTTTCGGCCTTCATCTCGTACCTGACCGCACGTGACGTCAATGCCCGTCCGAAAAGCGCACAGAAGGCGTTGGATCGCCTCCGTGAGCTCATGCCCACGCTGAGCCGCCAGGCATTGGCTATCGCTTCCGCCCCCAGGAACCACCCATCAACAGCACTCGGGTGTTCCCAATGGGTGCG

Hello,

imho the main problem is your Forward primer: according to the sequence you provided two mismatches can be spotted. The most critical one is a C (reference) to A at the 3'-end of your primer, exactly in the last position. I don't know why you put a mismatch there, but the last 3' nucleotide of your primer is the most critical one and you should avoid putting mismatches there at all costs . So:

1) If the mismatch is there for a good reason I suggest to, at least, generate a longer primer at the 3'-end to avoid a mismatch in the last position.

2) If the mismatch is not critical I suggest you to change the last nucleotide of your fwd primer to a C (i.e. ACCATGGTGGATACTACGGCACACGGC).

Along with d  forward primer i used another reverse primer ATAACTTCCGGTAGAGCCTCCATATGG with dis it is working so good and i'm getting amplification but with the another reverse primer

5' CGCACCCATTGGGAACACTCGAGTGCT 3'  with this its not working

ATGGTGGATACCACGGCACACGGCACGGACCACTACAATCTCATTGACGGCCGCTACCGCATTGTGCGCAAGATCGCGGATGGCGGCATGGCCACGGTGTACCAGACCGTCGACGAAAGGCTCGGGCGCAATGTGGCGGTCAAAATCATGCACATGCAGCTGGCCCAGGGCCCCCACCGCGAGCAGTTCATCGAGCGCTTCCGACGGGAGGCCAAATCCGCGGCAGCAATAGCCAATCCGCATGTGGTGCAGGTGTACGACACCGGTGAGACGAATGGCTCGTACTATCTGGTCATGGAGTATGTGCACGGCGTGAATCTGCGTAGTCAGATGCAGACGCACACCACGTTCTCGGTGCGCGACACCCTGCGCATCGTCGGCGAGACATTGAACGGACTTGCCGCCGCCCACGAGATCGGCGTCGTACACCGCGACATCAAGCCGGAGAACATTCTGATCAACGACCGCGGTCATGTGGAGATCACCGATTTCGGCCTAGCCAAGGCCGCCTCGCAGGCCACGCTCTCCTCCACCGGGATGCTGCTTGGCACAGCGGCCTATCTCGCCCCGGAGATGATCGAAAACAACCAGGCCACTCCT

CAGGGCGACTGCTATTCCGTGGGCATCATGGCATGGGAGCTGCTGGCGGGGAGGGTGCCGTTCCAGTCAGACAATCCGGTGACGATGGTGTTCAGGCACGTCAACGAGAACATCCCCTCCATAGGAACGGTGTGCTACGGCATCGACCCCCGGGTTTCGGCCTTCATCTCGTACCTGACCGCACGTGACGTCAATGCCCGTCCGAAAAGCGCACAGAAGGCGTTGGATCGCCTCCGTGAGCTCATGCCCACGCTGAGCCGCCAGGCATTGGACTATCGCTTCCGCCCCCAGGAACCACCCATCAACAGCACTCGGGTGTTCCCAATGGGTGCGAATGAGCAGGATTCCGACCGTCCCTCCGTTTCGAGCAAATCGGATTCGCCGGAAGAATCCACTCCACCACCTACCTCTGCCGCCGCGCTTTTCACTGCATTGGCCTCCCCCGATCTCACTGAAGAGGAGGCGGAACAGGCAAGAACGGTAGCTCTCGCCACACCGCCGGACGACTCCTCGACGCCAGGCTCTGGGGTTCCGGCCTCCGGTGGAACCACCGTTCCACCATATGGAGGCTCTACCGGAAGTTAT

I'm not able to map the new rev primer in your ref sequence so I assume it is outside the ref in 3', correct? Anyway, It's still unclear if the mismatch at the 3' end of the fwd is required. If not I suggest to modify it. This should greatly increase the overall efficiency of your amp. Note also that several of your primers have palindromic sequences: this also significantly affects the overall eficiency of the PCR reaction.

First, correctness of the reaction reagents must be checked individually. In particular Taq DNA polymerase enzyme and DNA template.

In the next step, be sure to verify the performance of the thermocycler 

May be useful in PCR amplification to dilution your PCR template.

Check whether PCR is working or not