Dhanashree --

8 Questions 28 Answers 0 Followers

Questions related from Dhanashree --

How to plot fraction of the cell recovered v/s concentration of the drug ?

Kindly let me know how to plot a graph as followed in the publication (Publication link attached below).

08 August 2017 675 1 View

How to Identify the interacting partner from whole cell protein ?

The gene X has been taken from host namely Z, cloned and expressed X in E.coli. I would like to understand the interaction partners of X protein in host A. As X is his-tagged protein, purified and...

05 May 2017 8,872 6 View

How to attain the desired dilution factor for particular CFU ?

Hello , I 'm having the total count of 1.75*10^13 CFU/mL of bacteria. For the assay, I need 5*10^5 to 1*10^6 CFU/mL. To understand the total dilution factor which I shall use for attaining the...

10 October 2016 6,235 6 View

How can one determine the ori site of plasmid is compatible with the bacteria of interest or not?

pT181 cop-634ts repC4 ori this is the ori site. I just wanna know whether it's compatible with probiotic organisms. How can I detect this, Kindly help me.

04 April 2015 6,407 5 View

What might be causing no amplification in PCR?

5' ACCATGGTGGATACTACGGCACACGGA 3' 5' CGCACCCATTGGGAACACTCGAGTGCT 3' These two are forward and reverse primers for gene which I want to amplify, but I tried with 40 to 66 annealing but thing is I'm...

08 August 2014 6,929 21 View

Is it difficult to isolate membrane proteins from gram positive bacteira. and how the protocol will be very different from negative to positive

Hello I'm getting so many protocols for gram negative bacterial membrane protein isolation but not even single for the gram positive bacteria. Kindly help me for the same

08 August 2014 6,860 1 View

Can anyone help with my 2.2 kb amplification?

I have amplified 1.04kb and 1.16 kb fragments, then I went for touch down PCR by using these two fragments as template to amplify the 2.2 kb of my desired gene. I got amplification of 2.2 kb with...

06 June 2014 2,743 3 View

Why wasn't I able to get clones even after treating with CIP?

I believe vector ligation is the main problem. I'm using pBluescript for cloning and my insert around .8kb and 1.3 kb fragments but unfortunately I'm getting more background and due to that I...

05 May 2014 2,192 22 View