8 Questions 28 Answers 0 Followers
Questions related from Dhanashree --
Kindly let me know how to plot a graph as followed in the publication (Publication link attached below).
08 August 2017 758 1 View
The gene X has been taken from host namely Z, cloned and expressed X in E.coli. I would like to understand the interaction partners of X protein in host A. As X is his-tagged protein, purified and...
05 May 2017 8,955 6 View
Hello , I 'm having the total count of 1.75*10^13 CFU/mL of bacteria. For the assay, I need 5*10^5 to 1*10^6 CFU/mL. To understand the total dilution factor which I shall use for attaining the...
10 October 2016 6,327 6 View
pT181 cop-634ts repC4 ori this is the ori site. I just wanna know whether it's compatible with probiotic organisms. How can I detect this, Kindly help me.
04 April 2015 6,479 5 View
5' ACCATGGTGGATACTACGGCACACGGA 3' 5' CGCACCCATTGGGAACACTCGAGTGCT 3' These two are forward and reverse primers for gene which I want to amplify, but I tried with 40 to 66 annealing but thing is I'm...
08 August 2014 7,005 21 View
Hello I'm getting so many protocols for gram negative bacterial membrane protein isolation but not even single for the gram positive bacteria. Kindly help me for the same
08 August 2014 6,947 1 View
I have amplified 1.04kb and 1.16 kb fragments, then I went for touch down PCR by using these two fragments as template to amplify the 2.2 kb of my desired gene. I got amplification of 2.2 kb with...
06 June 2014 2,778 3 View
I believe vector ligation is the main problem. I'm using pBluescript for cloning and my insert around .8kb and 1.3 kb fragments but unfortunately I'm getting more background and due to that I...
05 May 2014 2,234 22 View