Hi Agu,

For identifiction of Actinomycetes , you have to isolate DNA and ensure it is not contaminate with proteins, RNA etc. Select the Primers for DNA, specifically for actinomycetes (Universal Primers are available from many laboratories). Go through the PCR amplification for DNA. After the DNA amplfication sent the samples for sequencing labs. You may get the DNA code sequences for actinomycetes. After that do BLAST analysis in Genbank for similarity search with available species. or you may simply send the isolated Actinomycetes DNA to sequencing labs for 16s RNA Seqencing.

Hi,

You need to extract the actinomycetes DNA and then go for 16 S rRNA gene PCR amplification using Universal Primers 16S1 (GAGTTTGATCCTGGCTCA) and 16S2 (ACGGCTACCTTGTTACGACTT). Sequence the PCR product and analyse using BLAST.

All the Best.

Hi.

16S rDNA gene sequencing using universal primers and then analysis of the gene using BLAST will help you to identify actinomycetes at molecular level. For DNA isolation you can use kit or do it manually followed by PCR reactions. You can follow specific papers for that.. 

Thanks. Please is 16S rRNA sequencing similar to 16S rDNA sequencing. Secondly can you suggest a reliable laboratory that can perform molecular characterisation of Microbial Isolates with fast turn around time to me. I need answers urgently please

16S rRNA sequencing and 16S rDNA sequencing is one and the same.. We send our samples to First base, Malaysia and Scigenom Labs, India. The quality value of sequencing is good here.. We do 16S rDNA sequencing for molecular characterisation. DNA extraction we do manually or use kit.

You can read my research article if you need where I have described the manual procedure for DNA extraction from Actinomycetes.

Here is the link..

http://journal.frontiersin.org/article/10.3389/fmicb.2016.00347/full

Article Broad Spectrum Antimicrobial Activity of Forest-Derived Soil...