In Cao et al. 2016 they use golden gate cloning to generate lenti-multi-CRISPR plasmids. In Table S2 they list their primer pairs and in primer F1 there seems to be an extra nucleotide (G) between the vector overhang sequence (CACC in red) and the guide sequence (CTGCAAAATTCGGCCGCCCA in blue). What is the purpose of this extra nucleotide? Is this required?
Saeed Bozorg Qomi
Hello dear Jonathan
U6 RNA polymerase III promoter used to express the sgRNA prefers a guanine (G) nucleotide as the first base of its transcript, an extra G is appended at the 5′ of the sgRNA where the 20-nt guide sequence does not begin with G.
So this is not necessary, but it improves the efficiency of editing.
1 votes
0 thanks
- Badges
- Science topic
More Jonathan R. Flynn's questions See All
Similar questions and discussions