What is the recommended rpm used to pellet out yeast cells and is it necessary to carry out in cold conditions?

More Surajvanshikumar Suvarna's questions See All

How to apply Hiddem Markov model for DNA sequence ?

Good morning to all if i have following random DNA sequence then how to find intron and exon manually for Hidden Markov model...

03 June 2023 5,447 2 View

Regarding intron and Exon in DNA sequence?

For example i have hypothetical small DNA sequence with 30 bp i.e AGCTTGGCAATCGGTAGGCTAGATCGTACCT. Now i want to count how many transitions between Intron, Exon and Splice site manually. can...

19 April 2023 3,766 5 View

HIdden Markov model?

How to train HMM in R. i tried with depmixs4 but show error for my data.

08 April 2023 3,023 2 View

Example for LHMM?

Can anyone give me the numerical example for Layered Hidden Markov Model Layer should be grater than or equal to 2. Thankyou

19 March 2023 7,350 3 View

Best software for drawing Markov plot?

What is best Software or website to draw Transition diagram or Markov plot freely Thankyou

13 March 2023 3,397 1 View

Regarding Markov chain when data is binary?

Hello Everyone, For example i have 3 states Markov model i.e Healthy, Sick and Death. i collected data in the last year. data form is like yes or no for each. Simple example is Healthy state...

18 December 2022 6,063 4 View

Regarding Diabetes chromosomes ?

which chromosome affected diabetes(chromosome 6 ?) or any other also. and also suggest me where i can get chromosomes list wise diseases and gene Thankyou

03 December 2022 7,549 7 View

Regarding DNA sequence?

Good morning, How to predict next generation DNA sequence by Hidden Markov model. I read some material about but unable to get for example my random sequence is ATCGAAGTCCCGGATCGATGA from this...

02 November 2022 6,567 3 View

Regarding DNA sequence, how to know?

i want to know how to find intron and exon in DNA sequence let my sample be CTGTTGGTGCAATGCCACGGAGACATGGGTGACCTATGGAACATGTTCTCAAACTGGTGAACACCGACGA Thankyou

27 October 2022 140 2 View

How to convert Intensity (V/MicroAmps) in to Intensity(CPS/MicroAmps) unit in emission spectrum?

While recording emission spectrum the Y axis will show the unit Intensity(CPS/MicroAmps).I recorded spectrum in IR range where the unit showed as Intensity (V/MicroAmps).How to interconvert this?

15 August 2022 8,548 0 View

How much Yeast should we add to fermentation media?

I have prepared a liquid broth containing Yeast (S. Cerevisiae) that i need to add from it to fermentation media of lignocellulosic hydrolysate. I need to know based on what parameters do we add...

06 August 2024 662 1 View

Are there instances where molecules with larger molecular weights exhibit greater mobility than those with smaller molecular weights?

Hi, I know that low molecular weight (MW) molecules generally tend to have higher mobility, while high molecular weight molecules tend to have lower mobility. However, in my experimental...

06 August 2024 1,495 2 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

The Curse of Evolution and Complexity?

Brain and body mass together are positively correlated with lifespan (Hofman 1993). The duration of neural development is one of the best predictors of brain size, and conception is the best...

05 August 2024 6,247 3 View

For an in-vitro drug release study, what molecular weight cut-off (MWCO) dialysis bag is required for a 117 kDa protein?

kindly reply me. Thanking you in advance.

05 August 2024 7,727 4 View

How to isolate lymphocytes from mouse spleen?

I have tried several times to isolate lymphocytes from mouse spleen, but all attempts have been unsuccessful. I tried most available protocols. I used different dissociation media (HBSS with Ca...

04 August 2024 9,913 7 View

How to start a Molecular Dynamics Simulation?

Is it possible to conduct a molecular dynamics simulation to see the effects of a specific carbohydrate on the structure of lipids (e.g., micelle structure)? I am a beginner in this field and plan...

03 August 2024 3,371 3 View

Which will be the best software for the Hydration shell analysis with molecular dynamics?

I am using a windows system, what software I should use for hydration shell analysis with molecular dynamics?

02 August 2024 3,143 4 View

Can anyone provide me with molecular docking softwares/ websites?

Molecular docking software/ websites?

02 August 2024 8,704 7 View

Does anyone have issues using Prepman Ultra reagent for MicroSeq ID bacterial, fungal and yeast sample preparation?

I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...

01 August 2024 2,079 0 View

Karen A. Darbinyan Popular answer

200-250 rpm on orbital shaker. Add about 0.8-1.2% (depends from yeast type) Tween 80 for good pellet formation. Example see picture.

Karen A. Darbinyan

Surajvanshikumar Suvarna

what about in centrifuge to carry out dna analyis?

Irene Stefanini

You meant you need to pellet down yeast cells prior DNA extraction? in this case, 10000g x 15 minutes should work, but it depends on the yeast species and strain. You could increase up to 13000g, but it could affect the DNA integrity.

Yes i got it.. Thankyou

Diego Andres Díaz-Dinamarca

12000g x 5 minutes it's enough. I hope it helps you. regards