I know, IRES enables the coordinated co-expression of two genes with the same vector, used for the expression of two proteins separately.
But I found two kinds of IRES sequences in my plasmid database and literature. Here it is:
IRES:
TCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAA
IRES2:
CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTACACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACC
Somehow, I want to know what is the difference on the expression level of these two sequences. Someone said IRES2 will decrease the expression of the second gene compared with IRES, is it true? Could IRES keep same expression level of two genes (I know people will suggest 2A peptide, but I do not want to introduce any amino acids on my protein)?
The efficacy of IRES sequences can vary greatly depending on cell types, so it's not really possible to say if one sequence is better than another. In addition, your IRES sequences are practically identical.
Even with 2A peptides, the second protein is expressed at lower levels than the first due to inefficient translation. The main benefit of the 2A system is ensuring that the 2nd protein is always expressed in conjunction with the first protein (e.g., if you have Gene1-2A-GFP, all GFP-positive cells will express Gene1 too).
The terms "IRES" and "IRES2" refer to different types of internal ribosome entry sites (IRES) used in molecular biology to regulate translation initiation. Here's a comparison of IRES and IRES2 and their potential effects on gene expression levels:
In summary, while both IRES and IRES2 elements serve as internal ribosome entry sites that can enhance translation initiation, IRES2 elements are typically optimized for improved translation efficiency and may result in higher levels of protein expression compared to natural IRES elements. The choice between using IRES or IRES2 elements depends on the specific experimental requirements, desired expression levels, and compatibility with the expression vector and host system.
your two ires are (almost) the same (they differ by one nucleotide and the number of A in a poly(A) stretch (could be a sequencing pb)... it is the traditionnal (EMCV virus) ires found in many cloning vector & the most efficient ires.
The difference between using an IRES (Internal Ribosome Entry Site) and an IRES2 lies in their efficiency and specificity in driving gene expression in a bicistronic mRNA.IRES (Internal Ribosome Entry Site): IRES is a sequence element within the mRNA that allows ribosomes to initiate translation internally, bypassing the requirement for a 5' cap structure. When an IRES is present in a bicistronic mRNA, it enables translation initiation of the downstream gene even if the ribosome is still translating the upstream gene. However, IRES elements are generally less efficient than cap-dependent translation initiation, leading to lower expression levels of the downstream gene compared to the upstream gene.IRES2: IRES2 is an improved version of IRES that has been engineered to enhance its efficiency and specificity. IRES2 sequences have been optimized to increase translation initiation rates and reduce leaky scanning (initiation at inappropriate start codons). As a result, IRES2 elements typically lead to higher expression levels of the downstream gene compared to traditional IRES elements.In summary, while both IRES and IRES2 facilitate translation initiation of downstream genes in bicistronic mRNAs, IRES2 generally offers higher expression levels due to its improved efficiency and specificity.
- Badges
- Science topic
- Similar topics
- Biological Science
- Biochemistry
- Biochemical Techniques
- Analytical Chemistry
- pH