I have used the following procedures but am still having strong primer dimer bands while the desired product is absent.
The cycling conditions for PCR program that i used were 5 min at 95C for activation followed by 35 cycles of 95oC for 30 s for denaturation, 55oC for 30 s for annealing, 72C for 30s for elongation and a final cycle 72C for 10min for final elongation
the primer used are
F: CAGCCATACAGGGCATCCAG
R: ACAGATGGGTGTGTGGGGAT
and expected pcr product size is 250
please i need a help about what is wrong
Hi,
The conditions are ok,
But when you Blast your primers the are giving many hits in the genome. try to pick and design those primers that gives a single hit on the desired gene.
You can see in the image they one of your primer is giving 7 hits and the other is giving 3 hits. So it will bind at all these places and not give the desired product.
Kindly redesign your primers,
You can massage Mr. Farooq, he has sequenced this gene.
Farooq Ahmad
Best wishes,
You can try the gradient PCR. Your primer looks good after blast (it gives expected product size, 250 bp).
1) Try check the quality of sample that you use for amplification
2) Try gradient PCR to get the optimal annealing temperature
3) Try positive and negative control to see if the pcr enzyme is in good condition
Good Luck!
There are many causes you need to investigate:
- PCR cycling conditions are not optimal
- Quality of the template is poor
- Low template concentration
- Presence of Inhibitors
- Not specific primer(s)
- There is too much starting template
In your place, I would try to check first the quality and quantity of NA extract, and then use higher annealing temperature (60 degrees) with lower primers concentrations (10 pmol primer for 50ul PCR reaction)
Hi,
Check the above mentioned quality issues.
Your primers should be specific for the target. You may use the In-Silico PCR tool in the UCSC genome browser to look into that. It is clear that the melting point for your primer is well above 55 deg C, rather 62-63 deg. C.
I would suggest to use a touchdown PCR protocol, starting at the melting point of your primers and then lower the temperature in increments of 2 degrees, e.g. 62 deg. C for 3 cycles, 60 deg. C for 3 cycles, 58 deg. C for 3 cycles and 55 deg. C for XX cycles (as much as you need).
In this way you have a high specificity (but low efficiency) of primer binding at the start of the thermo cycling but you increase the yield more and more by later reducing the temperature of annealing when you already have produced many copies of your desired target.
- Badges
- Science method