I would like to identify (by 16SrRNR sequencing and blasting) bacteria (pure cultures) prevalent in a soil. Which primer pair or sets of primer pairs would be the most useful for that reason?
Modestas, the attached link has some ideas that may hold some use for you:
http://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=4&sqi=2&ved=0CDAQFjADahUKEwiPs_aM3obIAhVGbj4KHdgJA1s&url=http%3A%2F%2Fwww.researchgate.net%2Fpublictopics.PublicPostFileLoader.html%3Fid%3D538bae4cd5a3f2c8568b459f%26key%3D6a85e538bae4c5ccdf&usg=AFQjCNGXVtwCfT_0YslCuUk7S7ePAIP40g&sig2=A_yCg5Q8H-Z4fjVb34Fl0w&bvm=bv.103073922,d.cWw
Universal eubacterial 16S rDNA primers, fD1 - 5'-GAG TTT GAT CCT GGC TCA-3’ and rP2 - 5'-ACG GCT AAC TTG TTA CGA CT-3’ (Weisburg et al., 1991). The PCR cycling conditions were as follows: an initial denaturation for 5 min at 95 ºC, followed by 30 cycles of denaturation at 94ºC for 1 min, annealing at 59ºC for 1 min and extension at 72 ºC for 2 min and then a final extension for 5 min at 72ºC.
Thank you for the answers. Please provide sequences of concrete primers if you have tested it and obtained good results. Thank's!
Here is a recent paper which asks your question, and supplementary table 1 of that paper from: http://www.arb-silva.de/download/archive/primer_evaluation/
This set of primers will work well
16SF:5’CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG-3’,
16SR: 5’CCCGGGATCCAAGCTTACGGCTACCTTGTTACGACTT-3’
Which primers would be more useful: those that help to amplify all or almost all 16S gene or those that amplify only certain part of the gene , for instance 550bp?
The primer sets i mentioned is for 1500bp amplification. For partial sequencing, 16SF (Forward primer) is enough to get good reads upto 1000bp.
We tried many primer pairs reported in the literature and settled for 27F (5′ -AGAGTTTGATCMTGGCTCAG-3′ ) and 511R (5′ -GCGGCTGCTGGCACRKAGT-3′ ). In our experience, this pair works well for anaerobic digester and soil samples.
Liu AC, Chou CY, Chen LL, Kuo CH* (2015) Bacterial community dynamics in a swine wastewater anaerobic reactor revealed by 16S rDNA sequence analysis. Journal of Biotechnology 194: 124-131. DOI: 10.1016/j.jbiotec.2014.11.026
http://dx.doi.org/10.1016/j.jbiotec.2014.11.026
Thank's for the clear answer! What size (weight in bp) of the product should be obtained with this set of primers?
As the names implied, this pair will amplify ~500bp of the 16S 5' end. After adding the barcode (for multiplexing) and sequencing adaptors, the final product is suitable for either 454 Jr. or Illumina MiSeq paired-end platform.
We and our collaborators use 63f+1387r (5’- CAGGCCTAACACATGCAAGTC + 5’-CGGCGGWGTGTACAAGGC).
We use it for soil and permafrost isolates.
Marchesi, J. R., Sato, T., Weightman, A. J., Martin, T. A., Fry, J. C., Hiom, S. J., & Wade, W. G. (1998). Design and Evaluation of Useful Bacterium-Specific PCR Primers That Amplify Genes Coding for Bacterial 16S rRNA. Applied and Environmental Microbiology, 64(2), 795–799.
Just go through the link: http://www.earthmicrobiome.org/emp-standard-protocols/16s/
if you are looking for next gen sequencing, you can have a look on attached article
Article Evaluation of general 16S ribosomal RNA gene PCR primers for...
Hi Modestas Ruzauskas
All of this was three years ago. Did you find your set of primers of soil bacteria identification? I am doing the same in my lab by sanger sequencing and now I have the same question that you had three years ago.
Thank you in advance
The best way now is to use NGS. Anyway the universal primers like 27F and 515R can help to determine genus, but not species. I still don't know the best set of the primers for reliable determination at the species level...Maybe because species in procaryotes sometimes is too artificial and subjective level of taxonomical unit:)
Thank you! Glad that you answer in such a short time. Last, do you have the sequence of the 515R? I only have 27F and 511R.
27F (5'-AGA GTT TGA TYM TGG CTC AG-3'), 515R (5'-TTA CCG CGG CKG CTG GCA C-3')
27F (5'-AGA GTT TGA TYM TGG CTC AG-3'), 515R (5'-TTA CCG CGG CKG CTG GCA C-3')
Where do I buy them from? Modestas Ruzauskas
As time has passed, there are now further publications describing applications and benchmarking resolution and performance of different 16S regions by application:
Article A comprehensive benchmarking study of protocols and sequenci...
https://www.eurofinsgenomics.eu/en/next-generation-sequencing/ngs-built-for-you/inview-microbiome/inview-microbiome-profiling-30/
Article Resolving Species Level Changes in a Representative Soil Bac...
At a recent conference I have also seen a nice droplet microfluidic approach based on fusion-PCR to combine two amplicons from different 16S regions of the same cell (per droplet) into one fragment for Illumina sequencing with much improved species resolution and cell counts. I am looking forward to this being published.
- Badges
- Science method