STAT3 inhibition, optimal conc and incubation time, for monocytic cells?

Nadeem Akhter @Nadeem-Akhter

04 July 2021 0 5K Report

Hi Dears,

I will be grateful, if some one shares with me the optimal concentration and incubation time of STAT3 inhibitors.

STAT3 Inhibitor III, VI and V.

regards,

Badges
Science topic

More Nadeem Akhter's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,776 1 View

How can we minimize the cross-pollination of Chilli (Capsicum annuum L.) in field condition of Sylhet region to retain parental characteristics?

Fruits of different chilli germplasms are showing completely different fruit shape, however, as all these germplasms are indigenous and I would like to know field level techniques and ways to...

13 March 2024 6,848 1 View

Can anyone help me with developing NABL documents for accreditation of food products by chemical test?

I wish to get NABL accreditation for my chemical procedure of testing food products as per FSSAI

01 March 2024 8,009 0 View

Why cancer often metastasizes to the lungs?

How do the intricate molecular and microenvironmental dynamics within the lungs create a preferential niche for the metastasis of various cancer types, and what specific molecular mechanisms...

21 November 2023 8,702 1 View

Does long-term culture of murine Monocytes result in macrophage differentiation?

Hi, I am isolating monocytes from the bone marrow using the Mouse Monocyte EasySep kit. I want to treat these cells and monitor expression of specific markers over the course of 10 days. I will...

04 August 2024 7,282 2 View

Can i use the protease inhibitors during cell membrane vesicle preparation ？?

I am currently working on a project that involves extracting cell membranes, for which we disrupt the cells using sonication. During the initial extraction process, we add protease inhibitors to...

30 July 2024 7,077 1 View

Detaching human-derived monocytes?

Hi, I need help in detaching adherent monocytes from well plates. I isolated the PBMCs from buffy coat and I did CD14+ positive selection to collect only the monocytes. I let them adhere on my...

20 July 2024 7,922 2 View

How do you determine the Ki of an inhibitor for an enzyme which also undergoes substrate inhibition?

There are three factors involved in the activity, the substrate acting as a substrate, the substrate acting as an inhibitor and another inhibitor for which you want to measure the Ki.

08 July 2024 4,987 1 View

How to incease the yiald of recombinant protein expression ?

Hello esteemed scientists, I am endeavoring to increase the yield of my recombinant protein. It is a 120 kDa protein tagged with MBP and features three intrinsically disordered regions with pI...

12 June 2024 9,616 8 View

Is it hard to stain CCR2 for flow cytometry?

Hi, I'm working on the immune cells in the heart and have a problem with CCR2 marker. I did some research and found there's CCR2+ monocytes in heart failure mouse model. When I analysed CCR2...

08 June 2024 7,315 5 View

Can you explain the potential toxicity and overdosemanagement of commonly used antiplatelet drugs?

Antiplatelet Therapy: Mechanisms, Indications, Administration Can you explain the potential toxicity and overdosemanagement of commonly used antiplatelet drugs?

05 June 2024 6,447 1 View

How to prepare 0.28 U/ml working solution of Acetylcholinesterase inhibition assay for anti-Alzheimer activity?

I have purchased Acetylcholiesterase from Electrophus electricus (electric eel), C3389-2KU, following details are written on the enzyme vial. Type-VI S lyophilized powder 200-1000 Units/mg...

31 May 2024 6,444 1 View

Can anyone interpret why the absorbance in alpha amylase assay get increased with increased standard (inhibitor) concentration?

Can anyone interpret why the absorbance (DNS assay method) in alpha amylase assay get increased with increased standard (inhibitor) concentration? it should be decreased with increased standard or...

26 May 2024 4,753 2 View

Should the target miRNA level decrease after the miRNA inhibitor transfection when checked with qPCR??

I have a question regarding target miRNA expression after transfection with antisense miRNA (miRNA inhibitor). I understand that the expression of the target miRNA will increase after mimic...

20 May 2024 5,920 4 View