RFLP technique for GABRA2 gene in Alcoholism.
Its rs279845 SNP in GABRA2 gene.
This is the sequence which I retrieved from NCBI-SNP database.
AATTAATATCCCAGTAGCTTCTGGAG[A/T]TTCTAAGAGATAATGCACTCTGTGT
Did you put each potential allele in separately?
If you put the sequence in as you have displayed there, the program cannot recognize the cut site.
If you but in the "A" allele, the site exists and the sequence is "cut" by Hinf1 (shown below).
If you put in the "T" allele, HinF1 no longer cuts the sequence.
NEBcutter requires FASTA format. To denote the possibility of either a T or A nucleotide, you need to use a "W" at that position. With a W, your sequence is recognized as having a HinF1 site. Another approach, as James said, is to input the alleles separately.
Yes sir, I got it. Thanks so much James Borrone sir and Daniel Cohen sir .
- Badges
- Science method