I am facing a problem regarding smearing in PCR amplification since two months. But, before six months the results was there using the same primers at 67.2-degree celsius annealing temperature, 5% DMSO, and 1.5mM Mgcl2. But Now there is smearing in the gel. I have changed buffer, Taq pol, dNTPs, primer aliquots, tank TAE buffer, and also changed DMSO, Mgcl2 concentrations.
My product size is 1478bp, attaching an image of the gel.
Primers using
>FP—
GCACTAGTTTATGCCGGCAAATTCAGATGCGC
>RP
CCAAGGTTTTACGCTCGCGGCGCAAACTCGCG