Hi,

You might want to look at RNAeval from the Vienna package ("The RNAeval web server calculates the energy of a RNA sequence on a given secondary structure"):

- http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAeval.cgi

Given the following sequence :

ACGATCAGAGATCAGAGCATACGACAGCAG

and the following structure:

..((((...))))...((........))..

It tells you that the is -2.9 kcal/mol

External loop : -300

Interior loop ( 3, 13) GC; ( 4, 12) AU: -240

Interior loop ( 4, 12) AU; ( 5, 11) UA: -110

Interior loop ( 5, 11) UA; ( 6, 10) CG: -240

Hairpin loop ( 6, 10) CG : 540

Interior loop ( 17, 28) GC; ( 18, 27) CG: -340

Hairpin loop ( 18, 27) CG : 400

ACGAUCAGAGAUCAGAGCAUACGACAGCAG

..((((...))))...((........)).. ( -2.90)

Here is the link for the command-line program:

https://www.tbi.univie.ac.at/RNA/RNAeval.1.html

Hope this helps,

Marcel

The so-called "entropy " doesn't exist at all.

During the process of deriving the so-called entropy, in fact, ΔQ/T can not be turned into dQ/T. That is, the so-called "entropy " doesn't exist at all.

The so-called entropy was such a concept that was derived by mistake in history.

It is well known that calculus has a definition,

any theory should follow the same principle of calculus; thermodynamics, of course, is no exception, for there's no other calculus at all, this is common sense.

Based on the definition of calculus, we know:

to the definite integral ∫T f(T)dQ, only when Q=F(T), ∫T f(T)dQ=∫T f(T)dF(T) is meaningful.

As long as Q is not a single-valued function of T, namely, Q=F( T, X, …), then,

∫T f(T)dQ=∫T f(T)dF(T, X, …) is meaningless.

1) Now, on the one hand, we all know that Q is not a single-valued function of T, this alone is enough to determine that the definite integral ∫T f(T)dQ=∫T 1/TdQ is meaningless.

2) On the other hand, In fact, Q=f(P, V, T), then

∫T 1/TdQ = ∫T 1/Tdf(T, V, P)= ∫T dF(T, V, P) is certainly meaningless. ( in ∫T , T is subscript ).

We know that dQ/T is used for the definite integral ∫T 1/TdQ, while ∫T 1/TdQ is meaningless, so, ΔQ/T can not be turned into dQ/T at all.

that is, the so-called "entropy " doesn't exist at all.

.

.

.

Why did the wrong "entropy" appear ?

In summary , this was due to the following two reasons:

1) Physically, people didn't know Q=f(P, V, T).

2) Mathematically, people didn't know AΔB couldn‘t become AdB directely .

If people knew any one of them, the mistake of entropy would not happen in history.

Please read my paper and those answers of the questions related to my paper in my Projects.

https://www.researchgate.net/publication/230554936_Entropy_A_concept_that_is_not_a_physical_quantity