We are doing siRNA transfection in mammalian cells (suspension). The primers for target gene amplification were designed manually.
As per the instruction provided by the siRNA generation kit, the T7 primers were designed as follows:
5’ leader sequence (GCG), then T7 promoter sequence (TAATACGACTCACTATAGGGAG) and then the designed primer sequence specific to the target at 3’ end. The reaction conditions used for the target gene amplification are (94oc x 3 min: 94oc x 30 sec: 58oc x 30 sec: 68oc x 1 min/ 1 kb and 68oc x 5 mins). However, we are not getting any amplification in the reaction.
Now my query is, what are the key-factors for designing T7 promoter primers for the aforementioned purpose?
Are there any other suggestions/ proposals to improve the research methodology?
What stage did your problem rise? No PCR product or no T7 transcription?
Also this description is not as clear as you would like it to be: "5’ leader sequence (GCG), then T7 promoter sequence (TAATACGACTCACTATAGGGAG) and then the designed primer sequence specific to the target at 3’ end."
Can I interpret it as (the whole designed sequence in one piece):
GCG TAATACGACTCACTATAGGGAG --the sequence specific to your target---
Is it in a plasmid? I hope not. Therefore, then,how did you try to PCR the piece on DNA? That is, where is the reverse primer? Even what is the forward primer? GCGTAATACGACTCACTATAGGGAG or TAATACGACTCACTATAGGGAG?
Or maybe, you have the whole piece PCR amplified successfully. But T7 transcription did not go well??
If you can clear these issues, people will be able to target more to the point.
Dear Yanglong Zhu , thanks for your prompt reply.
1. We did not get any PCR amplicon. So the problem is at the PCR amplification stage.
2. The PCR primers are like this:
5'-GCG TAATAC------- ------------AGGGAGA AGGCA...------------ AGT-3'
i.e.
GCG then Promoter seq. then specific primer sequence.
we were testing the efficacy of the primer-pairs in the cDNA reverse transcribed from blood (the gene of interest is expressed in blood cells).
Should you have any query please let me know.
Please give your comments & suggestions in this regard.
Thanks
I still don't quite get it yet. This is your forward primer?
5'-GCG TAATAC------- ------------AGGGAGA AGGCA...------------ AGT-3'
At the end of it is the start codon? Still where is the reverse primer? If you had a reverse primer, how many PCR reactions have you performed before? That is, are experienced enough to troubleshoot the issue. For example, did you run the reaction product on a gel to examine the issues? You can post the gel image so we can have a look.
Until you tell me whether you have a reverse primer and / or a gel image I have nothing to add.
Sir, I have already mailed you at Research Gate. Please check your mail at Research Gate account.
The primer detail has been added and the gel shows no amplification in the PCR with cDNA.
Thanks
Dear CS Mukhopadhyay.
Did you test the cDNA by PCRing other normal/house keeping genes to see if the transcription was okay?
Yes I tested it with other primers (including Housekeeping).
these have already yielded positive results.
Though additional sequences at 5' end do not make big differences for the amplifications, the primer sequences on their own (even without non complementary extra 5' sequences) can be difficult to give results. I think you can decrease the annealing temperatures and see if you can amplify. Or change the primer sequences.
- Badges
- Science method