We are doing siRNA transfection in mammalian cells (suspension). The primers for target gene amplification were designed manually.
As per the instruction provided by the siRNA generation kit, the T7 primers were designed as follows:
5’ leader sequence (GCG), then T7 promoter sequence (TAATACGACTCACTATAGGGAG) and then the designed primer sequence specific to the target at 3’ end. The reaction conditions used for the target gene amplification are (94oc x 3 min: 94oc x 30 sec: 58oc x 30 sec: 68oc x 1 min/ 1 kb and 68oc x 5 mins). However, we are not getting any amplification in the reaction.
Now my query is, what are the key-factors for designing T7 promoter primers for the aforementioned purpose?
Are there any other suggestions/ proposals to improve the research methodology?