5' GGCATGTAACGAATTTCTTC 3'
+++ |||
3' CTTCTTTAAGCAATGTACGG 5'
dG: 1.5
Data from Gene Runner
Here attached you can see the major dimer structures for your own primer. Not the best kind of structures but I saw perfect-looking primers working bad and bad-looking primers working well, for me you have nothing to worry about. Definitely worth the try.
good luck
Hello Flavia
further to Paolos answer find a link to a a word doc prepared by me on drop box which expalins good primer design including links to software sites that will look at self annealing via hairpin loops/palinodromes and inter annealing between forward and reverse primers culminating in primer dimers; Have a look below
With specific regard to your structure, the simple answer is you have absolutely nothing to worry about. I say this because many of these compliments are theoretical predictions and in reality exist fleetingly in an actual PCR reaction; that is effectively not at all. If you look at this putatiuve hybrid it cites a dG of '1.5'. This delta G refers to the free energy of the predicted hybrid; In other words how stable it is in reality and how in a steady state environment it is likely to exist. Structures with delta g values of -10kCal or over are predicted to be stable and therefore might pose an actual problem in real time and in the 'real' steady state world. Yours does not. Generally speaking in my experience you should only worry and dG values are >/= -10kCal if
1. The complimentary bases are at the very ends of primers
2. The bases annealing are G and C
3. The number of G/C bases is 3 or more and next to one another
If the above conditions are not met then primers will not anneal to one another because of steric hinderance, i.e they cannot bind freely to one another and will anneal so weakly that the structures fall apart as fast as they form - in other words the stady state level of this structure is minimal - or the denaturation temp of the PCR cycle will cause these structures to simply melt
I hope this helps !!
https://www.dropbox.com/s/m4vfq4wjscnkm7w/PRIMER%20DESIGN%20document_updated%200414.docx?dl=0
I am using the following criteria for primer designs:
1. dG must be higher than 5
2. the last 3' bases must be free from internal pairing and better also from pairing with the second primer. Often shifting the primer sequence a few nucleotides helps to find a good primer.
3. Contrary to statements often made it is not very omportant whether the 3' nucleotide is C/G or A/T.
4. I am avoiding long internal pairing sections if possible
I a do not use primer programs but I always check for internal pairing, dG and pairing with the second primer. For the initial sequence I just coose a section with as much heterogeneity in bases as possible (no runs of the same base for 3 or more).
Wolfgang, please, do you say that dG must be higher than "-5" or "+5"?
thank you!
Hello Flavia
I would say -5kcal/mol as I tend to advocate -10
To reiterate, the dG is a measure of potential free energy linked to a theoretical dimerisation; I say theoretical because unless the predicted dimer is thermodynamically stable in the steady state real world in real time it probably wont exist blow either -5 or -10. That is it would be too unstable to exist within any sort of significant half life. In other words even if it were to form it would dissociate as quickly as it came together and thus pose no real problem to ytour reaction
- Badges
- Science method