Flavia Saiki

2 Questions 3 Answers 0 Followers

Questions related from Flavia Saiki

Arlequin software results do not show up, why?

When I try to run my data, I get the screen shown in the image. When I click the "View Results" button, it opens a web page, but the page says "Not Found." The same issue occurs when I try with...

02 March 2025 7,139 0 View

Is it a problem to have a positive dG in primer self dimer?

5' GGCATGTAACGAATTTCTTC 3' +++ ||| 3' CTTCTTTAAGCAATGTACGG 5'dG: 1.5 Data from Gene Runner

25 May 2015 4,378 6 View