2 Questions 3 Answers 0 Followers
Questions related from Flavia Saiki
When I try to run my data, I get the screen shown in the image. When I click the "View Results" button, it opens a web page, but the page says "Not Found." The same issue occurs when I try with...
02 March 2025 7,143 0 View
5' GGCATGTAACGAATTTCTTC 3' +++ ||| 3' CTTCTTTAAGCAATGTACGG 5'dG: 1.5 Data from Gene Runner
25 May 2015 4,392 6 View