@Flavia-Saiki

Flavia Saiki

1 Questions 3 Answers 0 Followers

Questions related from Flavia Saiki

Is it a problem to have a positive dG in primer self dimer?

5' GGCATGTAACGAATTTCTTC 3' +++ ||| 3' CTTCTTTAAGCAATGTACGG 5'dG: 1.5 Data from Gene Runner

25 May 2015 4,320 6 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close