I'm an undergraduate student and I do with WarmStart® LAMP Kit (DNA & RNA) NEB #B1700.
I set up the reaction at 65oC - 60 minutes/ 85oC - 5 minutes. I use LAMP to detect Pseudomonas aegruginosa and below is my primer:
F3: CAAGCGCAAGATAGTCGCC (19bp)
B3: TCCGCTTGAACAGGCTGGTG (20bp)
FIP: GAAGATATCCGGCTGGTTGCTTTTCAAGAGGGAATGCCGCAGT (43bp)
BIP: AACGGATCATCGGCATCCTGGTTTTCATCGCCGTCCACAGGTAGA (45 bp).
My period-making LAMP: 1st: no amplification ->2nd: successful (same protocol) -> 3rd: no amplification -> 4th: false-positive signals -> 5th: successful (same protocol) -> 6th: false-positive signals. From 6th, I modified the workflow by adding primers in the last step, but later the results give false-positive already.
Can anyone help me? :(((( My email is [email protected]
Thank youuuuu.
Have you done in silico analysis on your LAMP primers to make sure there is no cross-reaction between each primers or with your negative control samples?
Dear, Truc Nguyen
I haven't used LAMP primer. The following tips may help you to solve your problem.
1. Clean the micropipette properly with alcohol especially the tip of the micropipette (Area of work must be clean).
2. Set up the negative control and seal the tube/well before using a template for other reactions.
3. A single copy of the template is sufficient to get amplified therefore use a barrier (filter) micro tips to avoid aerosol which may contain a copy of the template.
4. Reactions can be set up in laminar air flow to avoid any contaminant.
5. Different places for the setting of negative control and reactions (Positive control) can be employed.
5. Use sterile/UV treated NFW.
6. Use a single aliquot of PCR components for one time reactions.
- Badges
- Science method