How to obtain EGFP localization to the nucleus in N2A?

More Sara Mingu's questions See All

Could someone please provide a list of journals that accept the application of methodologies in nature-based solutions?

I am looking for journals that admit the publication of results from applying the IUCN Standard for designing and monitoring Nature-based solutions. Many thanks for considering my request.

23 July 2024 6,444 2 View

Pink bacterial colonies?

I am cloning an overexpression plasmid with my protein of interest tagged with mScarlet. After transforming my ligated product into DH5α bacteria and plating on LB agar, I noticed colonies with a...

22 July 2024 5,953 6 View

Cell proliferation assays suggestions?

What cell proliferation assay do you suggest? cyQUANT from thermo Fischer has good reviews, a lot of good articles for the kit from Abcam. and Promega kits look easy and straight forward.

21 July 2024 1,554 2 View

How do you assign allele numbers and sequence type after amplifying housekeeping genes by PCR for MLST?

How to assign allele numbers and sequence type after amplifying housekeeping genes by PCR for genotyping of S. pneumoniae strains by MLST using bioedit ?

19 July 2024 5,239 2 View

How to make chocolate milk ?

we want to produce chocolate milk industrally .Dose anyone have a specific stabilizer formula for this pourpose?

10 July 2024 3,791 1 View

What is your understanding of Precision Medicine?

This forthcoming study aims to gauge public awareness of Precision Medicine and explore how AI and ML technologies can enhance healthcare outcomes. Please consider contributing to this research by...

12 May 2024 7,554 0 View

Efects from trauma in vitiligo?

is there anay resarch about how psychological trauma affects vitiligo?

10 May 2024 5,976 0 View

Matlab codes on the beamforming technique used in intellegant reflective surfaces technology?

I am looking for Matlab codes on the beamforming technique used in smart reflective surfaces technology. Can anyone help me? I would, of course, acknowledge your contribution and cite your work...

02 May 2024 3,957 1 View

Could you please anyone help me to rectify the following error in my gaussian input file?

When I specify the number of processors = 4, my calculation works fine. But when I want to specify the number of processors more than four, the program gives: "Will use up to 8 processors via...

30 April 2024 3,071 1 View

Sanger sequencing problems?

Hello, I have problems with PCR fragment sequencing (Sanger sequencing on SeqStudio). We perform sequencing reaction with BigDye™ Terminator v3.1 with subsequent purification with BigDye™...

29 April 2024 4,613 3 View

Why don't d-orbitals split themselves, why does it take a ligand? why don't protons from ligand repel nucleus split d-orbitals?

why don't d-orbitals split themselves because of themselves without the presence of ligands? Electrons are indistinguishable. Why wouldn't it be more correct that protons from a ligand split the...

03 August 2024 3,589 3 View

Why doesn't chromium 2+ ion use all its d-orbitals to receive lone pairs from six waters in [Cr(H20)6)]3+?

I'm guessing it's because the ligand experiences too much electron repulsion or proton repulsion from the chromium to insert them close to the 3d-orbitals which are close to the metal nucleus. Is...

03 August 2024 1,370 1 View

How to correctly use the UTE and ZTE pulse sequences in Bruker's ParaVision software?

I am using a Bruker 600M solid-state NMR spectrometer with a Micro 2.5 microimaging system. The test sample is a tube of 1M LiCl aqueous solution, and the nucleus detected is 1H. I am trying to...

01 August 2024 9,227 1 View

IHC profiler in image j software. has anyone used it to quantify nuclear DAB positivity?

Dear researchers. I tried using the IHC PROFILER in image j to quantify nuclear DAB staining. I followed the instructions in the original article by "Varghese F, Bukhari AB, Malhotra R, De A...

29 July 2024 2,229 0 View

How many events should be counted for the analysis of apoptosis with nuclear staining with Hoechst 33342 whit microscopy ?

Greeting How many events should be counted for the analysis of apoptosis with nuclear staining with Hoechst 33342 whit microscopy ? Are 100 events count sufficient and three repetitions for...

25 July 2024 7,520 0 View

How to perform immunofluorescence on suspension cells?

Some time ago, I wanted to perform immunofluorescence on the S protein of mouse CD4 T cells using a Leica super-resolution microscope. I fixed with 4% paraformaldehyde, then added it to the well...

20 July 2024 3,797 2 View

How Can I Resolve a Persistent Unwanted NMR Peak at 1.25 ppm?

Hello everyone, I am facing a consistent issue in my NMR spectra with an unwanted peak appearing at 1.25 ppm. This peak seems to vary with the amount of sample: it becomes more pronounced with...

15 July 2024 9,065 4 View

Why I have this weird green signal in the nucleus?

Hi, In a few wells and cells, we’ve noticed an unusual signal in the nucleus using both eppifluroscence & confocal microscopes. Does anyone know why this is happening? It occurred twice in...

10 July 2024 1,870 0 View

What are the criteria that must be retained for the development and validation of a qualitative NMR method ?

Dear Community, I would like to develop and validate a qualitative NMR method for the analysis of a specific category of chemicals, and my question is the following: What are the criteria that I...

08 July 2024 1,402 4 View

?como elimino articulos que no son propios?

eliminoar articulos que son de tu autoria

05 July 2024 2,107 1 View

Raj M Rajebhosale

you can use this NLS as a fusion with eGFP - PAAKRVKLD

ccggcggcgaaacgcgtgaaactggat

depending on where you add it (N or C terminal) you will have to add start or stop codon of course.

It might also help to add multiple NLS if you don't get sufficient nuclear localization.

Sara Mingu

Thank you for your answer! I will try this sequence.