How to obtain EGFP localization to the nucleus in N2A?

More Sara Mingu's questions See All

Do I need to strip the PVDF membrane before staining it with colloidal gold?

Dear Colleagues, After running Western blot on PVDF membrane and detection using ECL, I would like to stain my PVDF with colloidal gold to be able to allign the ECL image with total proteins on...

02 March 2021 7,829 3 View

Shall I skip the measurement model in SmartPLS?

Hello everyone, I had run a mediation model in SmartPLS using questionnaires that were already validated among my statistical population. A professor who edited my paper -though she is not...

01 March 2021 3,052 3 View

Have anyone checked before Cyclic voltammograms of intial ITO substrate and E-teck?

As a beginner in electrochemistry, I tried to obtain cyclic voltamograms of commercial anatase powder deposited on an ITO substrate or on Eteck. After several attempts, I noticed that my cyclic...

23 February 2021 3,175 3 View

Is it okay to mention you distributed your qualitrics study link through social media sites?

Just want to be clear and know it is okay to say I have distributed the qualitrics link through social media such as Facebook, Instagram and Twitter to ensure my target audience is reached in my...

21 February 2021 5,143 2 View

Why samples do not run in resolving gel?

Hello everybody, I have a problem with SDS-PAGE and I do not know why my samples stop at the top of the resolving gel and they do not run through it. The percentage of gel is 15% and the size of...

14 February 2021 9,116 6 View

Do you know of an informal caregiver of a person who has recently received a bone marrow transplant?

We are conducting a pilot study of an intervention for informal caregivers of persons who have recently received a bone marrow transplant in the US. If you know of anyone who might be interested,...

13 February 2021 9,174 1 View

Is it possible that the single-pass absorption exceeds 50%?

Dear researchers It's well-known that the maximum light absorption of any structure can not be greater than 50%. Is it possible that the single-pass absorption exceeds 50%? How?

17 January 2021 2,335 7 View

Most appropriate fit of a standard curve in an enzym-linked lectin assay?

Dear all, I have a question regarding the most appropriate fit of a standard curve in an enzyme-linked lectin assay set-up to quantify the amount of mucin secretion in conjunctival explant...

03 January 2021 1,010 6 View

How do I access Domestic Violence Attitude Scales or find them for free?

Hi, I'm a postgraduate student currently starting up a research project on attitudes towards domestic violence (DV). The study will aim to compare cultural differences between attitudes and...

31 December 2020 781 3 View

A good protocol for protein purification by AKTA?

Hi everybody, Does anyone have a good protocol for protein purification using AKTA? I have tried to purify two proteins but after several attempts it was not successful. So, I really appreciate...

28 December 2020 5,220 15 View

How do I determine the degree of polymerization of PEG 400 based on NMR integration?

Hello, I am working on the photocatalytic degradation of PEG 400. I would like to know if it's possible to determine the degree on polymerization based on NMR integration, or by the MW of the...

02 March 2021 6,186 3 View

Why does two different bioinformatics tools for the same proteins show different subcellular localizations?

During a computational analysis, I found that for a protein of a plant, two different subcellular localizations are seen using CELLO and WoLF PSORT. For example, in CELLO, it identified the...

01 March 2021 6,729 2 View

How to include original NMR data in a manuscript?

hello. i am junior researcher. I received a comment from a reviewer that he could not find NMR data in my submitted paper. I had included the NMR graph with explanation and formula to calculate...

27 February 2021 734 4 View

How to convert 2D stack images to 3D to obtain surface area of nucleus?

I have 15 slices of the nucleus at different z-heights from confocal imaging. I would like to use these slices to reconstruct the 3D nucleus and ultimately estimate the surface area of the...

20 February 2021 6,967 1 View

Is my GFAP staining in right position?

I was differentiate hESC to astrocyte. In the second week of differentiation, I stained my cell with s100beta and GFAP. I expected that the staining site of GFAP would come from the cytoplasm,...

15 February 2021 8,982 1 View

Does the property of GFP affect a fusion protein's localization?

Hello, I am planning to insert GOI between CaMV 35 promoter and mGFP in pCambia1302 to produce a fusion protein and see subcellular localization of the protein. But the vector says it's membrane...

15 February 2021 4,353 3 View

Which database could provide the signal sequence for targeting various cellular regions? ?

I am searching for thee database which could provide me signal sequence specific to the various cell organelle. such as signal sequence for mitochondria, signal sequence for endoplasmic...

04 February 2021 6,650 2 View

What is impact of sampling frequency on deep learning?

Greetings, everyone. I am a bit curious to know how the sampling frequency of the device that captures the physiological signals impact the deep learning process. For example, if a device abc...

03 February 2021 379 4 View

Can anyone recommend me a NMR Handbook?

Hi, I've been searching for a NMR Handbook with 29Si chemical shifts information but I can't find one. Also I've tried to find an online database with that kind of info but I have no lucky. Can...

02 February 2021 307 3 View

How to calculate cross correlation of two signals from the same source one of which is going through a filter ?

A signal is split into two parts and one of them is going through a filter (say, with a transfer function H(f)) and the other part stays unchanged. Then I want to know how to calculate their cross...

01 February 2021 5,101 8 View

Raj M Rajebhosale

you can use this NLS as a fusion with eGFP - PAAKRVKLD

ccggcggcgaaacgcgtgaaactggat

depending on where you add it (N or C terminal) you will have to add start or stop codon of course.

It might also help to add multiple NLS if you don't get sufficient nuclear localization.

Sara Mingu

Thank you for your answer! I will try this sequence.