Hi everyone
I am doing a next gen sequencing project to identify miRNA in brassica. I made the small RNA libraries and sent them for sequencing and subsequent analysis. The data that I got back shows a lot of novel miRNAs and also some novel miRNAs with similarity to already known miRNAs in miRbase. For eg. aaaacggaaucguaagcuuc is called siimilar to osa-miR2121a (whose sequence is aaaacggagcgguccauuagcgcg). The similarity between these two miRNAs is between 2-8nt. Same criteria is for other miRNAs.
My question is how should I interpret this data? When doing clustering of miRNAs in families which sequence should I use? I think similarity at seed region can not be used as a criteria for clustering!
I would welcome any kind of suggestions.
Thanks
For miRNA clustering you can apply various approches
1. Based on seed region.
2. Based on full length matches with reported miRNAs in miRBase (take all the miRNAs including animals and worms).
3. Based on target genes.
Read few papers given in miRBase which describes how they have annotated and what are the criteria for miRNAs (if you want to identify canonical miRNAs only).
I am not a specialist of miRNa, but a good review that can help :
Taylor, R. S., Tarver, J. E., Hiscock, S. J., & Donoghue, P. C. (2014). Evolutionary history of plant microRNAs. Trends in plant science, 19(3), 175-182.
Taylor et al. is the way to go. Be VERY careful with miRBase - 60% is garbage.
- Badges
- Science topic
- Similar topics
- Chemistry
- Biochemistry
- Biomolecules
- Nucleic Acids
- RNA
- Small RNA