How can I use EDFSurf to generate data and publication quality figures re Residue Depth and Cavies for my PDB structures?

12 September 2014 1 3K Report

I am unable to download EDTSurf from the site. The windows executable file does not run. Is there an online site which takes the PDB file as input and gives appropriate output in form of data/figure as Depths and cavites?

Any help will be appreciated.

Thanks!

Conference Paper Fast and Accurate Calculation of Protein Depth by Euclidean ...

A. Rouboa

Dear Khawar,

I suggest that you go to the online service of "Zhang Lab On-line Service System", they can help you.

Good luck,

Regards

Abel

Badges
Science topic

More Khawar Sohail Siddiqui's questions See All

Forecasting with known copula parameters?

I want to calculate the Mean absolute percentage error (MAPE) for my copula model. I am stuck at the forecasting step. I am not specifying the copula here for different data pairs. 1. I have two...

14 July 2024 7,604 1 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

How to generate data from copula parameters for forecasting and model comparsion?

Hi, I have parameters of time-varying normal copula. Now I want to forecast using these parameters. For that I will need to generate data using these copulas parameters as shown in the...

20 May 2024 488 0 View

How can i check whether urea/denaturant has been removed from my protein after dialysis ?

i am refolding protein by gradient dilaysis in which i gradually decrease concentration of urea by gradient dialysis. however im not getting surety wheather denaturant has been completely removed...

24 April 2024 5,399 1 View

For copula modeling of time series data, why are standardized residuals of fitted ARIMA/GARCH required instead of directly using time series data?

Hello, I have read that for standard copula modeling, you can get empirical cdf of data and use it for copulas. But for time series data, we must first fit ARIMA/GARCH, get standardized...

11 February 2024 2,463 1 View

Time Varying copulas Empirical analysis steps?

Hello, All papers I have read about time-varying copulas just produce tables, but none explains exact steps for empirical data. How do I calculate the time varying parameters for the copula? I...

18 December 2023 5,453 1 View

Can someone please suggest me a protocol for Electrophoretic mobility shift assay (EMSA)?

I have to check that whether my purified protein interacts with DNA for which i need to perform an EMSA. I am unable to design this experiment properly so need some tips and suggestions. Thankyou...

04 December 2023 3,864 0 View

Can someone explain that why my 0.7% agarose gel takes 2 hrs to run and also some suggestions on cloning for bacterial two hybrid experiment?

I am doing cloning of a big bacterial insert (3705bp) into a vectors of varying sizes ranging from 3017bp to 3469bp for my bacterial two hybrid experiment. Among other problems with my cloning I...

15 November 2023 7,101 4 View

How to prepare the Torodial shape sample of Mechanically Alloyed FeCoNiAlMn1-xCrx High Entropy Alloy Powders?

I have 6 different powder samples of Mechanically Alloyed magnetic High Entropy Alloy Powders as FeCoNiAlMn1-xCrx (x=0,0.2,0.4,0.6,0.8,1). I need to measure there microwave absorption properties...

24 July 2023 3,412 0 View

How to Add Missing Water Molecules in Protein-Membrane Simulations?

I have protein-membrane simulations (PDB, PSF, DCD) and have noticed that water molecules near the protein are not visible in the simulations. How can I fix this issue? Is there a way to place the...

04 August 2024 1,200 2 View

How to Import Blade geometry from CAD file in ANSYS design modeler?

Hello. I have the geometry of a blade in CAD file (stp) and I want to prepare the blade for meshing with turboGrid. I must import this file into designModeler and then transfer to the...

27 July 2024 356 3 View

How can I use DFT-D3 correction ( Siesta version 5.0.1)?

Dear Siesta Users, I installed Siesta 5.0.1 and I want to use Grimme's D3 correction. According to the 5.0.1 manual, I could use a few parameters to include the D3 correction in the...

27 July 2024 5,748 0 View

Flow through curved domains?

Hi everyone, I am working on a curved domain in which a ship is situated in the middle (geometry is given below). In my understanding the general fluid flow is parallel to the x axis from inlet to...

25 July 2024 9,058 4 View

Is it true that there is a physico-statistical meaning to the constant π other than circular geometry but the iron guardians of the SE deny it?

We assume that there is a physico-statistical meaning to the constant π other than circular geometry, but the iron guardians of the Schrödinger equation deny this. The iron guardians of the...

22 July 2024 4,285 9 View

How to apply virtual site for a polymer?

Dear All, I have a PDB structure for a complex and large polymer. I need to perform MD simulations using the OPLS-AA force field. I obtained the force field parameters from LigParGen and created...

11 July 2024 5,109 0 View

I am carrying out an experiment on Trichoderma. How can I measure OD of the fungal growth after 7 days?

I am carrying out an experiment on Trichoderma and need to measure OD of the fungal growth after 7 days. Unlike bacteria, fungus clump together making It difficult to get OD for the fungal growth....

11 July 2024 6,251 1 View

How to prepare proteins for multiple Ligand Docking with PyRx?

Hello everyone, I have been trying to understand the concept of performing docking for repurposing studies. I've watched a couple of tutorial videos about docking with Pyrx, but at some points, I...

29 June 2024 860 3 View

How to import STL format into ANSYS APDL?

Hi everyone, I want to import an STL geometry (surface meshed with 2D meshes) into ANSYS APDL. After importing, I also want to mesh the structure with SOLID187 elements to convert it into a solid...

25 June 2024 4,286 4 View

A new interesting geometry problem. Can you find the measure of angle?

In the isosceles triangle ABC (AC=AB), the angle at the vertex is 20°. Point D is chosen on the side AB such that AD=BC. Find the measure of angle CDB.

23 June 2024 7,541 8 View