I am currently optimizing PCR for amplification of the ITS2 region for fungi and V4 region for archaea/bacteria from environmental gDNA. This amplification is being done using degenerate primers appended with Illumina Nextera adapters (as detailed below). The PCR product from this first round will be submitted to a sequencing facility on campus for a second round of PCR where indices will be added, then sequencing will be carried out on an Illumina MiSeq.
I have encountered two issues:
1) After running an annealing temperature gradient, I am still uncertain which annealing temperature to use for the V4 primer set.
2) Both ITS2 and V4 primer sets are yielding non-specific product which show up as a faint smear with some diffuse 'bands' in my gel.
I've attached a gel image of the Ta gradient (annotated in PowerPoint) which depicts both issues.
For issue (1), my Ta gradient yielded virtually identical bands across more than 20C span of annealing temperatures – from 50C all the way up to 72C. This makes it difficult to select an annealing temperature based on the gradient results. Based on these results, I could select a Ta as high as 72C and run a two-step protocol, but I’m worried that I may miss some taxa by selecting a Ta which is so far above the lower Tm. I am using a popular V4 primer set (515f-Y/806rB, see below) that has a large difference in melt temperatures. Under the buffer conditions used, the Tm of the forward primer is 74C, whereas the Tm of the reverse primer is only 56.6C.
Does anyone have experience with this primer set?
Is it expected to get similar amplification over such a wide range of annealing temperatures?
Why do so many people use a primer set that does not conform to the basic rules of primer design, yet nobody talks about this in the literature or elsewhere? ;)
For issue (2), both the ITS and V4 product has non-specific smears at higher molecular weights above the expected bands. For ITS some of this may be due to varying ITS length in the potentially complex community from which the gDNA was derived, but the V4 product is expected to be ‘cleaner.’ I tried titrating the primer and shortening the extension time for the ITS reaction to little affect, but haven’t had time to troubleshoot the V4 reaction yet. I suppose I would start by titrating the primer concentration. The cycle count is high, but I would like to optimize at the highest expected cycle count assuming that lower cycle counts will yield cleaner product.
I’m wondering if anyone has experience with these primer sets and whether this amount of non-specific product is common?
Is this caused by degeneracy in the primers?
I anticipate that the presence of non-specific product will reduce the number of usable reads in my sequencing results at the very least. Should I be concerned about this, or proceed with the second round of PCR and sequencing?
PCR Protocol:
Polymerase: Invitrogen Platinum SuperFi 2X MM
Recipe:
MasterMix (2X) 5 uL
Forward primer (10 uM) 0.5 uL
Reverse primer (10 uM) 0.5 uL
Tmeplate (10 ng/uL) 1 uL
PCR Water 3 uL
Total Reaction volume 10 uL
Thermocycler Program (based on Invitrogen suggested protocol for SuperFi polymerase):
Cyc1 (1X) 98C for 2 min
Cyc2 (35X) 98C for 10 s
(50-72C) for 10s
72C for 15 s
Cyc3 (1X) 72C for 5 min
Cyc4 4C HOLD
Primers:
All primers have the following Illumina adaptors appended:
Forward – TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Reverse – GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
Tm listed below for each primer was calculated at www.thermofisher.com/tmcalculator
For ITS,
ITS3mix (forward)
CATCGATGAAGAACGCAG 61.1
CAACGATGAAGAACGCAG 61.2
CACCGATGAAGAACGCAG 63.7
CATCGATGAAGAACGTAG 54.5
CATCGATGAAGAACGTGG 60.8
CATCGATGAAGAACGCTG 61.1
ITS4ngs (reverse)
TCCTSCGCTTATTGATATGC 62.5
Tedersoo, L., Anslan, S., Bahram, M., Põlme, S., Riit, T., Liiv, I., … Abarenkov, K. (2015). Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. MycoKeys, 10, 1–43. http://doi.org/10.3897/mycokeys.10.4852
For V4,
515f-Y (forward)
GTGYCAGCMGCCGCGGTAA 74
806rB (reverse)
GGACTACNVGGGTWTCTAAT 56.6
Walters, W., Hyde, E. R., Berg-lyons, D., Ackermann, G., Humphrey, G., Parada, A., … Jansson, J. K. (2015). Transcribed Spacer Marker Gene Primers for Microbial Community Surveys. mSystems, 1(1). http://doi.org/10.1128/mSystems.00009-15.Editor
Hello Michael,
as for the ITS PCR I think 60°C would be a good choice with regards to your photo.
I´m not sure if the phenomenon you see is actually an unspecific amplification product or just an unimportant smear that will have no influence on your sequencing result. I would suggest that you simply try and run a sequencing analysis with the products of both PCRs. Maybe they are okay. It´s not that expensive anymore. If this smear does interfere with your sequencing analysis than you can still go on trying to find a solution for your problem.
Best wishes
Dirk
Hi Michael,
aside from varying annealing temperature you could change other parameters, such as polymerase conc., primer conc., (and if you have it separate, i.e. not already included in the buffer, the MgCl2 conc).
If you still get non-specific products, you could try gel extraction:
Cut out the bands you are are interested (i.e. the correct amplicons) from the gel. Then extract the DNA from the gel slice. You can use a scalpel to cut out the bands using a scalpel or razor blade--I assume you are interested in the strong, dark bands and not the faint ones). You could then use the Qiagen QIAquick gel extraction kit to extract the DNA from the gel slices.
It's an extra step and certainly a bit fiddly, so I would not recommend that if you have hundreds of samples, but it might be worthwhile if you have only tens of samples. I have had good experience with that. I had a similar problem trying to amplify MHC loci, and was not able to get rid of the non-specific products,. However, once I did the gel extraction and re-amplified, I only got one distinct band on the gel, which also produced very nice sequences.
I hope this helps.
Cheers, Oliver
- Badges
- Science method