Dear Noha 

Since you want to know the expected size of your amplicon I would recommend you to use an insilico PCR freeware (AmplifX). You can get the FASTA sequence of Homo sapiens vitamin D (1,25- dihydroxyvitamin D3) receptor (VDR), RefSeqGene on chromosome 12 from NCBI NG_008731.1 (Your gene of Interest) and use the primer sequences you obtained from a paper against the above sequence and run PCR on AmplifX. You will know the size of your amplicon. When I did with the primer information you provided I found your primer pairs are amplifying a region of 720 bp VDR segment and I also found that the reverse primer is binding at an undesired site too.

All the best

Here is the link for insilico PCR

http://crn2m.univ-mrs.fr/pub/amplifx-dist 

depends on your primer..calculate the bp between your reverse and forward primers..

I guess you have the primer sequence with you, if so jus search it in the template sequence..you will get it.!!

Hi Noha,

You have many options to find the product size of the PCR. As you already have the primer sequences, BLAST it. you will get the genome details from it. You can download the paricular gene from NCBI or any other source and find the primer position in it. Both the forward and Reverse. Then you can manually count it. If you need more informations or if you want me to do it and send it you, send your primer sequences to me. I can help you. All the best.

i can obtain the gene sequence but i don't know how to determine and locate the specific polymorphism in the sequence. also i don't know to locate the primers sequence in the gene FASTA sequence

e.g VDR gene

i work on one of its SNP (rs7975232)

the FASTA seq for the polymorphism is

AAGGCACAGG AGCTCTCAGC TGGGC

M

CCTCACTGCT CAATCCCACC ACCCC

according to the guide paper

forward primer: cagagcatggacagggagcaag

 reverse primer: gcaactcctcatggctgaggtctca

i can obtain the gene FASTA sequence but i don't know neither to   locate the polymorphism nor the  primers sequence in the gene FASTA sequence

thanks for you but i need to know the steps not just the result

Dear Noha,

SNPs can be a difficult task to resolve but here are some steps that you can follow. Taking in mind the example that you posted here (i will use this one) you should:

1) Identify your mutation. You have done that  by providing the NCBI SNP code: rs7975232

Go to the NCBI website and from the pull down menu choose SNP. Then paste in the right hand side the above snp code. You will be  provided with a link referring to this mutation. This provides you with the actual nucleotide change in red, so you can directly see which mutation are you looking for to study. Click on that and it will provide you a full decription of the mutation, including sequence and other useful information.

2) Somewhere around there you should see a little graphic of the sequence where the nucleotide change is highlighted and a coloured bar runs vertically on it. Look left and right of that snp position and copy a few nucleotides on each side. Paste that fragment that includes your snp into an alignment software since you have the whole gene sequence and see whereabouts it is located on the gene. You can do the same with the suggested primers, or you can design your own. 

If you do the above you will have your result

Best wishes,

Nikos

Dear Noha 

Since you want to know the expected size of your amplicon I would recommend you to use an insilico PCR freeware (AmplifX). You can get the FASTA sequence of Homo sapiens vitamin D (1,25- dihydroxyvitamin D3) receptor (VDR), RefSeqGene on chromosome 12 from NCBI NG_008731.1 (Your gene of Interest) and use the primer sequences you obtained from a paper against the above sequence and run PCR on AmplifX. You will know the size of your amplicon. When I did with the primer information you provided I found your primer pairs are amplifying a region of 720 bp VDR segment and I also found that the reverse primer is binding at an undesired site too.

All the best

Here is the link for insilico PCR

http://crn2m.univ-mrs.fr/pub/amplifx-dist 

Adding on Pranay's answer you can either cut out the band of interest from your gel if you amplify two products and purify it, or slightly alter the reverse primer sequence so you will avoid the reverse primer mispriming.

Nikos

Your forward primer matches the VDR gene at positions chr12:48,239,029-48,239,050 which is in an intron as per BLAT at UCSC. 

Your reverse primer matches the same gene at positions chr12:48,238,306-48,238,330

which is in the 3'UTR of the same gene. These are unique matches in the human genome. You can calculate the size of your PCR product by taking the difference between the two external coordinates: 48,239,050 - 48,238,306 = 744 bp

Your polymorphism matches the intron portion of the gene at chr12:48,238,149-48,239,525. Does it affect splicing?

You can repeat the procedure yourself by logging in at http://genome.ucsc.edu/, select the human genome hg19 and select Blat under Tools. Type your primer sequences (one at a time) and follow the links. Good luck.

Simply provide your primers to the NCBI Primer Blast. It will give you many intersting information incliding any possible PCR product length.

Let me know if yu have problem.

Cheers,

Hamid

I think that, as advised by my predecessor simply enter your primers to the NCBI Primer Blast.

Best wishes,

Grażyna

Hi,

Its easy just use Primer Blast. See the attached video for finding out amplicon length / PCR product length.

http://youtu.be/04t6PbopFas

Here is another link for in silico PCR from the UCSC website. Just select the organism and paste your forward and reverse primers.

http://genome.ucsc.edu/cgi-bin/hgPcr?command=start

Download target gene sequence from NCBI and try to locate both the primers. Calculate the number of nucleotides present in between the primers. To it add the number of nucleotides present in each primers to obtain the expected size.

The link to Primer Blast is:

http://www.ncbi.nlm.nih.gov/tools/primer-blast/

All you need to do is enter the primer sequences (5' to 3') and select the organism and the database ("nr" includes everything).  You do NOT need to provide a template sequence or an Accession number. 

sequence it in the concerned company, and then blast the figures obtained by the company  in the ncbi ,you will get the definite sequence

By using website below and find attached video for learning.

https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch

Dears

You can find amplicon size from all as mention previously and from known forward and revers primers location according to the following equation 

amplicon size= (reverse primer location - forward primer location)+1

You can do an in-silico PCR. It searches a sequence database with a pair of PCR primers that you input. This is the link to the UCSC in-silico PCR.

https://genome.ucsc.edu/cgi-bin/hgPcr

Hello!

We have designed primers,  which were used for a PCR reaction. We obtained a PCR product size of about 1180 pb (even for the positive control). when sequencing those PCR products, they correspond to the cibled gene.

The problem is when I check the insilico expected size either by alignement or one of the technics suggested bellow or by using the next program which is so useful as well (http://www.bioinformatics.org/sms2/pcr_products.html). the expected size was completely different (it was about 1395 pb?!

Can someone help me to solve that?

 Hanane Djenane's question is also posted here--

https://www.researchgate.net/post/matching_between_insilico_PCR_product_size_and_agarose_gel_resultas_after_PCR_reaction

You can use the primer blast