Very Thanks for your replying, Actually I run my product on agarose gel first time, and it was as you said. Then I run them on poly acrylamide gel (15%) with 100bp ladder after standard PCR only. I suppose this would be Ok since it will detect even the sequences with 20-25 bp.

My miRNA is call 23b and my primers are from SIGMA: are

MiR23bRT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATCA

Universal Reverse primer: GTGCAGGGTCCGAGGT

MiR23bF: TGGGTTCCTGGCATGC

and the microRNA is UGGGUUCCUGGCAUGCUGAUUU

and I used the supperscript III  reverse transcriptase

and I extract my RNA using column from Qiagen and used Trizol method as well

Hi, I agree with Kamil.

I have usued the stem-loop RT and PCR system from Applied Biosystem before to amplify microRNAs and I have never had any problem. But, as well as Kamil, I make Real-Time PCR.

The microRNA with the stem-loop added by the RT primer in the reverse transcription reaction of the Applied system has a length of approximately 70 nts that is the sequence that you amplify in the PCR.

I've never made a gel after the PCR, but I guess that you should find a band of approximately 70 nts and probably you should also find another band corresponding to the primers.

If you have some problems to amplify your miRNA specifically, perhaps you can try to modify the PCR conditions to maximize specificity, for example by increasing the annealing temperature...

Hello, 

I, too, have not had any problems with the stem-loop RT-qPCR assays from Life Technologies. I was wondering, though, whether your RNA extraction method is appropriate for miRNAs - have you checked with the kit you are using? I have had very good results with the DirectZol-kit from ZymoResearch, which retains RNA species down to 17 nt in length. 

Good luck!

Hi, I've used stem-loop primer for miRs detection and amplification and had the same problem. check if your DNase I treatment step works well, DNA contamination could cause nonspecific band in your PCR. moreover, use higher annealing temperature in your PCR, it also helps to get rid of nonspecific bands.

good luck!

Hey, you can also  use N CODE VILO microRNA kit from ABI.

In this protocol, you  need just design microRNA specific forward primer & universal reverse primer already provide in kit. one important advantage to use this kit is that u can detect microRNA in SYBER Green chemistry means very economic.

many Thanks I am on it.

Hi Mohammed Albedhawi

I want to measure the miRNAs expression by stem loop RT PCR too. But my sample is animal cell culture. I would like to ask you, can I follow the same protocol as you did.

Please tell me back,  

Pnnapa pinweha  

Thank you very much ^^

Hi Pannapa,

Actually I do not know, Since I have tried to do so but I did not work with me. So I am postpone it for a while.

wish you all success with your attempts, please let me know if its work with you, 

Mohammed 

which reverse transcriptse do you recommend for stem loop PCR