During IHC staining of neuromuscular junction in Drosophilla larvae why Normal goat serum (5%) is used along with primary and secondary antibody?

More Sarooj Nadeem's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

QSPR model is not fit for or it does not deliberate best answers. How we can improve it?

The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.

29 August 2023 7,764 2 View

What the difference exists between the QSPR analysis by using 2D and 3D model of drugs structures?

Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?

27 August 2023 552 2 View

How to establish a Mathematical Model on "Transfer of heat in human body organs"?

I'm looking for a mathematical model for transfer of heat in human body organs especially (eye, heart, brain and lungs). How is the behavior of heat transfer at normal and extreme levels

12 July 2023 4,888 2 View

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

Do I need specific antibodies to stain for a fusion protein?

I am staining some brain sections stored in cryoprotectant that express a Histone H2B- GFP fusion protein that were generated ~10 years ago. I know I need to enhance signal with an anti-GFP...

07 August 2024 5,338 2 View

How to determine positive-stained cells in FACS? Use isotype or unstained control?

To compare positive and negative cell populations in flow cytometry, should I compare unstained cells with antibody stained cells? Or with the isotype control? Most papers show comparison with...

06 August 2024 6,728 6 View

Can I multiplex a mouse monoclonal and rat primary for IHC (mouse brain tissue)?

Hi all, I was just wondering if anyone has experience with multiplexing a mouse monoclonal primary and a rat primary. I'm trying to multiplex by incubating them in the same well but was told by a...

06 August 2024 9,710 1 View

Are there any commercially available Donkey anti-Alpaca secondary antibodies?

Are there any fluorescently labeled anti-Alpaca secondary antibodies raised in Donkey? So far I have only been able to find anti-Alpaca secondaries raised in Goat. Or is this not possible due to...

04 August 2024 4,255 1 View

Which solvent is better to dissolve with secondary metabolites extracted from fungi?

I work on MCF7 cell cell for anticaner purpose and I wa to do drug preperation the drug ( secondary metabolites extracted from Aspergillus) My question which solvent is better with these secodary...

03 August 2024 4,725 2 View

Senescence-associated beta galactosidase staining is False Positive in control group?

Hi guys If anyone is currently working on aging cells, you guys would like to give me some advice. I'm testing against biomarker (SA-beta-Gal), I encountered a false positive in the control group...

02 August 2024 6,735 1 View

What are the steps of formulating a herbal extract into a sheep/goat drench?

I am working on natural remedies for de-worming in small ruminant livestocks. Part of my project involves formulation of drench-type product, which I have not much experience in. My experience is...

30 July 2024 9,806 1 View

Suggestions for the Annexin V Positive Control ?

Hello everyone, I am currently using washed human platelets to stain Annexin V as a procoagulant marker. Additionally, I am staining with PerCP-CD61 to identify platelet cells. So far, I have...

29 July 2024 8,624 1 View

How can I get clearer background for my western blot?

I am running a western on HIV envelope protein. The size is around 50Kda and I am using rat anti-HA for the first stain and a second stain of mouse anti-CA. Primary antibody dilution is 1: 1000...

29 July 2024 6,484 5 View

Jasper B.J. Kamphuis

Hi, normally, serum (preferably of the same species in which the secondary antibody is produced, so I guess you're using goat-anti-X secondary antibodies) is used to prevent non-specific binding of your antibodies to any sticky sites.

Triet Bui

To block non-specific binding to Fc portions on your antibody.

Valeria Tananska

Both Jasper and Triet are correct.

A good article to explain more:

Article Dissection and Imaging of Active Zones in the Drosophila Neu...