How about NGS sequencing ?? It might be expensive but a very good option.

You need to state your question more precisely.  Are you interested in the rate of synthesis of rRNA?  Are you interested in the efficiency of processing of 45S precursor to 18S mature rRNA? Are you interested in the total per cell content of 18S and 45S transcripts?  Obviously, for reverse transcription, poly dT is not helpful, because these transcripts are not polyadenylated.  Random hexamers should work fine, but you do have to be careful that you don't add too much RNA to the reaction, because the amount of hexamer that will actually bind to the rRNA sequence could become limiting in the reaction.  If that happens, your qPCR will not be an accurate measure of the rRNA content.

A Bioanalyser can measure the ratio and amount of different rRNA's based on their size. It gives you a so called RIN value, used for RNA quality measurements.

Hi, thank you. I want to measure total RNA in different samples. I've tried random hexamer priming and am getting high Ct values for 18S rRNA and nothing for 45s rRNA. Could I use 18S rRNA and 45S rRNA specific primers to prime a cDNA synthesis reaction from a total RNA extract?

Yes you can use gene specific primers to prime cDNA synthesis, they should be designed in reverse orientation, because RNA has just one strand (+).

I strongly suspect a problem with your 45s rRNA primers.  Yes, there will be much less of the 45S species than of the 18S species.  For primers that I designed for human 45S and human 18S, there was ~13 Ct difference between the 18S signal (Ct was ~6) and  45S (Ct ~19) at the same threshold.  But I also had to test several pairs of candidate human 45S-specific pairs before I found one that worked well. One issue is that the 45S specific region is quite GC rich, so some of the pairs that I tested showed a relatively poor efficiency of amplification.   If your species is human or mouse, which I also designed and tested primers for, I can provide those primer sequences.  You also need to keep in mind that the primers you design for 18S or 45S will also amplify genomic DNA with the same resulting product---and there are multiple copies of these genes in the genome.  So you need to make sure that there is not a significant contribution of genomic signal to your measurement by running the appropriate controls ("no RT" or "RNA equivalent").

Thanks Martin and David. 

David, do you have primer sequences (human) for the cDNA synthesis reaction and qPCR primers therefore, for both 18S and 45S rRNA?

I would appreciate it if you could send me the qPCR reaction conditions you used as well as concentration of primers/ reactions volumes. 

Thanks again,

Jason

qPCR primers for human 18S (Note that these will also amplify 45S, but that will be a minor component of the product and can't be avoided by any design.)

18Sreg3F   5’ CTCAACACGGGAAACCTCAC 3’

18Sreg3R  5’CGCTCCACCAACTAAGAACG 3’

Product size is 110

Primers specific for human pre-18S (45S)

hs_pre18S_F4  5'  ACCCACCCTCGGTGAGA 3'

hs_pre18S_R4   5'  CAAGGCACGCCTCTCAGAT 3'

Product size is 46 (!)  Small product size keeps the melt temp of the amplicon for this GC rich region down, so that melting occurs quickly and completely during the cycling phase, which is essential for the overall efficiency of the PCR.

For the reverse transcription, we use the Quanta qScript cDNA supermix, which contains both random and poly dT primers, the latter not necessary here, but not harmful.  The maximum amount of RNA that we put into a 20 ul reaction is 400 ng to avoid RT primer limitations.  If you are only measuring 18S and 45S, you might consider adding even less RNA--200 or 100 ng, for an extra margin of safety with respect to RT primer limitation.   After the reverse transcription, the reaction is diluted with water.  I usually add 30 ul of water per reaction and use 4ul for each qPCR reaction.  In addition, when you measure the 18S, it is best to prepare a substantial further dilution of this reaction.  I usually add 4 ul of the initially diluted reaction to 196 ul of water (1/50 dilution) and use 4 ul of this further dilution for the qPCR.  This ensures that the Cts are not too low, as suggested by our Life Tech support.

Each qPCR reaction, performed with Quanta Perfecta Sybr Green Fastmix in a 20 ul reaction, includes 4 ul of diluted cDNA, 0.4 uM of each primer with water plus 10 ul of the 2x Fastmix to make up 20 ul.

Cycling conditions are: 95 for 30 secs, then 40 cycles of 95 for 1 sec and 60 for 1 minute followed by melt curve analysis.  Again, if you are only measuring 18S and 45S, then eventually  you should  really only need to run 30 cycles of PCR, since these should amplify and plateau well before 30 cycles.

In general, I think that any reverse transcriptase protocol or pre-mix with random primers should work ok.  If you use a different mix for the qPCR, you might have to optimize the annealing conditions in order to get a product with a simple melt pattern and product size.  Remember to include some no RT or RNA only controls to verify that your qPCR signal is coming from reverse transcribed template.  Also, keep in mind that  a very small amount of human DNA contamination is pretty much universal in the environment and these primers will amplify products from it--especially since there are a very large number of gene copies in the human genome.  So you should actually expect to see pretty good looking products showing up in any "no template" reactions that you do, but they should only appear at well beyond 33 to 35 cycles.  In fact, if you get such products in your no template reactions at 33 to 35 cycles, then you have actually succeeded!

Good Luck.

Thanks very much David. So you did not prime the cDNA reaction with 18/45S-specific primers? 

I will try using your qPCR primers with my random hexamer-primed cDNAreaction anyway.

Right.  Just random primers.

Okay, great, thanks, I'll let you know how I get on.

David F. Barker

Hi David,

Can I please also ask for the mouse primers?

Thanks a lot!

Shani

Shani Dror

The best mouse pre18s pair that I tested is:

mm_pre18S_F1 5'-AATGGTGCTACCGGTCATTC -3'

mm_pre18S_R1 5'-GGCGAGACAGTCAAACCAC-3'

Also, all of the suggestions that I made in above posts for use of the human pre18S primers apply to use of these mouse pre18S primers--same PCR conditions etc.

Comparisons that I made between 18S and pre18S qPCRs were made using the

18sreg3 primers mentioned in the above post for 18S. Those are "universal" primers for human/mouse/rat. No such design was possible for pre18S.

These primers should get you some clean data. What is less clear is how to interpret that data.....

Good luck,

David B.

Shani Dror

A couple of additional points:

1) The product size of the mm_pre18S pair above is 47 bp.

2) At least one commercial supplier of mouse "18S" primers actually provides a pair that is specific for "pre18S"--that is it will NOT amplify from mature ribosomal rRNA. For that reason, it is important that you know what the sequences are of the primers that you use for mature 18S measurement and check that those sequences will amplify the mature 18S product!

David F. Barker We’ve been working on amplifying human 45S rRNA but are facing challenges with inconsistent Ct values. So far, we’ve tried two different primer sets without much success. It would be really helpful if you could share the human 45s rRNA primer sequence.

Pranita Borkar Hopefully you already found the info that I provided in an earlier response on this thread . (Navigate to page 1 and go from there to find posts that I made on January 14, 2016).) That post also contains additional comments that you may find useful. Here is an excerpt.

Primers specific for human pre-18S (45S)

hs_pre18S_F4  5'  ACCCACCCTCGGTGAGA 3'

hs_pre18S_R4   5'  CAAGGCACGCCTCTCAGAT 3'

Product size is 46 (!)  Small product size keeps the melt temp of the amplicon for this GC rich region down, so that melting occurs quickly and completely during the cycling phase, which is essential for the overall efficiency of the PCR.