I have been trying to detect E6 and E7 in cell lines that are suppose to be either HPV negative or positive based on information (background) that the lines have varied percentages of HPV DNA. If a line has a low percentage of HPV DNA in it would the percentage of detectable HPV protein be low or even lower? Would I need a lot of protein to be able to detect HPV via a Western in a line with a low percentage of HPV DNA in it?
Hi,
below you can find primer sequences for detecting full length E6 transcripts (encoding the E6 protein) and spliced E6*I transcripts (likely to express E7 protein) from our paper (Häfner et al, Oncogene, 2008).
E6FL F AATGTTTCAGGACCCACAGG
R CACACAACGGTTTGTTGTATTGCTG
E6*I F AATGTTTCAGGACCCACAGG
R CTTTTGACAGTTAATACACCTCACG
What do you mean with "HPV DNA percentage"? The copy number per cell? Or do you have primary cultures with HPV+ and HPV- cells? The HPV copy number per cell does not fully correlate with the expression level. i.e. SiHa (2 HPV16 genomes) do not express much lower levels than CaSki (300-400 HPV16 copies).
Regards
Norman
Hi Norman!
Thank you for the information. I will look into having the primers designed and test them. I meant the HPV DNA percentages found in tissue samples of the cases of the disease that we are studying. There are 15-18 copies of HPV-16 in the line that I am working with (cancer cells).
Hi Gladys,
if you work with tissue samples the situation is more complicate because of several possible scenarios. i.e. many infected cells with low copy numbers vs. low number of infected cells with high copy numbers. Thus, the average percentage of HPV DNA in the tissue is likely to be not informative for some analyses without further information. Maybe you can estimate the number of infected and transformed cells by p16 staining.
- Badges
- Science method