My feeling is that closely related other sequences should produce good sequencing with some overlapping bases unless the other sequence has an indel within your sequenced region when it should start well and then immediately degenerate. Do you have both forward and reverse sequence of the mixed sequence? There are other reasons for poor sequencing such as conformational problems ( looping) of your template but can we see the original .abi file which will have much additional useful information about the electropherogram. Another possibility is that the random background signal is comparable with your sequence which can be caused by too little template, too little primer or the primer trying to anneal over a polymorphism and failing to produce good sequence but there are other possibilities. If it is a mixed sequence and the signal is good it may be possible to subtract the known sequence leaving the other sequence to blast against other species but you need to know if it is just poor sequencing first.

My feeling is that closely related other sequences should produce good sequencing with some overlapping bases unless the other sequence has an indel within your sequenced region when it should start well and then immediately degenerate. Do you have both forward and reverse sequence of the mixed sequence? There are other reasons for poor sequencing such as conformational problems ( looping) of your template but can we see the original .abi file which will have much additional useful information about the electropherogram. Another possibility is that the random background signal is comparable with your sequence which can be caused by too little template, too little primer or the primer trying to anneal over a polymorphism and failing to produce good sequence but there are other possibilities. If it is a mixed sequence and the signal is good it may be possible to subtract the known sequence leaving the other sequence to blast against other species but you need to know if it is just poor sequencing first.

thank you Chong. I will have a close look tomorrow but my first impression is that this is excellent sequencing up to the point where there is an insertion or deletion and then you have 2 overlapping sequences ...the original sequence and the sequence including the indel which is why the peak heights are smaller after the indel position because there is half the amount of each base at each position, If this is the case it may be possible to subtract the normal sequence leaving the indel sequence from the indel position hopefully giving a small deletion/insertion. If this is the case cloning and sequencing will confirm but I woill get back to you later.

best wishes

Paul

My next thought is that it is a one base indel as the runs of 3T and 3 A bases after base 88 in the forward two of the bases are clean in each case and only one has the expected 2 bases at the same position

Thank you very much Dr. Rutland. Hope to hear from you soon.

Regards,

Chong

can you post a text file of the amplified sequence please Chong

thank you

Paul

ok Thank you for the .abi files.All of the run conditions are good and the sequencing starts well and at the right time and the signal intensities drop off appropriately so the sequencing is good quality. I picked up a random mushroom ITS sequence to compare to your sequences and it is not a simple indel. you have 2 valid sequences. after the common motif agacttggtt there is another sequence of 203 bases which starts gctgggattaaacgtctctcggtgt and ends

tctcaaactcacttggg as a mixed sequence then both sequences are identical again with tttccaatt etc. Where these 2 sequences are sequenced together the electropherogram looks almost messy.

I know nothing about mushroom genomes but my feeling is that you can blast the underlying sequence to find out where it came from but that it is part of your species genome and is real rather than contamination or experimentally produced

Dear Dr. Rutland,

Really thanks for your fruitful comment and very sorry for later reply as I was busy with lab works. my sincere apologizes.

My thought after I got the sequence was that the background noise was quite a lot and messy. I was then told that the sample could be a mixed mushroom species.

In your opinion, do you think the sequences belong to 1 species or more than 1 species?

Thank you.

Regards,

Chong

What you have to do is align your forward and reverse with the reference sequence. At each position of the different sequence there will be 2 bases. One of these is the same as your reference sequence so make a note of the other base in every case. You now have the second sequence( alternatively clone the pcr product and sequence clones). You will have to blast this sequence to find out which species or genome it comes from. This may give you a better idea as to whether this is a mixed species.

You have to trust your sampling technique for whether the dna was made from one species. If the new sequence turns out to be something that you have amplified before it is a good idea to check your negative control to make sure that there is no post pcr contamination but as the rest have sequenced well then this is very unlikely