Data Analysis Software for Animal Health Economics ?

More Rizwan Ghasura's questions See All

How to convert ng/ul of DNA concentration to pmol/ul ?

Dear researcher, After amplifying my target gene (1900bp) into the required cDNA by PCR,>cut specific gel bands and purify the gel and the concentration was 30ng/ul. Next, performed A-Tailing...

21 January 2021 2,671 3 View

Can use Unigenes from RNA sequences for overexpression studies (transformation) without requiring a specific plant genome?

Dear researchers: If the plant genome has not been released yet, can Unigenes from RNA sequences be used after BLAST and confirmed with known Arabidopsis genes for function/overexpression...

20 January 2021 5,557 2 View

Can BLAST/ search by using known Domain in Transcriptome/Genome data for a gene family?

Dear Researchers, I have Transcriptome/Genome data and want to list all the member of a KCS/CER gene family whose Domain AP2/ERF, FAE1_CUT1, according to the Arabidopsis database, so is there...

15 January 2021 2,293 3 View

Is it necessary to measure the concentration of PCR/Gel purified product for A-tailing and TA cloning?

Dear Researchers, While working on plant gene transformation, so after cDNA + Gene Primer amplification, >the PCR/Gel were purified, so next for A-tailing and TA cloning is mandatory to...

12 January 2021 3,272 34 View

Can use the same vector for overexpression and transient expression?

Dear Researchers, I am using pCAMBIA1301/1302 vectors for overexpression study, so can use the same vectors for transient expression? or need to design another vector for transient expression;...

08 January 2021 7,975 2 View

Why negative controls also showing the specific bands of promotor and other regions (GUS, GFP etc.)?

Dear Researchers, I did a transformation of an empty vector (pCAMBIA1301/1302) into my passion fruit plants, for the optimization of the transformation protocol. After transformation; DNA...

06 January 2021 8,465 99 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

Which is the best book about Agriculture and Ecommerce course?

Hello dear colleagues / researchers/ teachers / please suggest the best book to teach graduate students about the course "agricultural and ecommerce" , thanks in advance.

10 September 2020 2,062 9 View

Can anyone explain the dynamic relaxation in DEM??

DEM is based on the dynamic relaxation. But we use this dynamic relaxation in FEM which is based on discretizing the continuum domain and assign the lump masses at the nodes. But, we don't do this...

02 August 2020 5,012 1 View

How many references sequences should use for a phylogenetic tree construction?

I have identified fungus isolates from the fruit surface by SSU +ITS+ LSU regions, such as : 1) Fusarium kyushuense , 2) Fusarium proliferatum ;3) Aspergillus aculeatus ;4) Aspergillus europaeus...

15 July 2020 5,573 2 View

How to compare two groups with only two measurements?

Hiiiii everyone! I have an enquiry on statistical analysis. I was looking for many forum and it's still cannot solve my problem. I want to compare means of two groups of data but only with two...

03 March 2021 8,796 3 View

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

What kind of fluid could I use for a pitfall trap that also does not invalidate molecular testing?

Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...

03 March 2021 5,978 5 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

Do we need to write protocol for a second study of a systematic review that has been registered and published?

I have conducted and published a systematic review and meta-analysis research with the topic related to public health and health pomotion (protocol was registed in PROSPERO). Now we want to...

03 March 2021 8,920 3 View

How to increase a model accuracy ?

dear community, my model is based feature extraction from non stationary signals using discrete Wavelet Transform and then using statistical features then machine learning classifiers in order to...

03 March 2021 6,994 5 View

1. What is the impact of having different scales in a survey? and how can we solve this problem before and after data collection (Literature)?

1. What is the impact of having different scales in a survey? and how can we solve this problem before and after data collection (Literature-based reflection)? Thank you for your time and for...

03 March 2021 2,870 3 View

What degree of missing data in a particular case/participant results in Expectation-Maximisation no longer working?

I'm dealing with a mediation model and am using the PROCESS module in SPSS. Due to SPSS and PROCESS being limited in the imputation methods - being unable to handle multiple imputation - the other...

02 March 2021 4,362 1 View

Do I need to do linear regression before running mediation analysis using PROCESS MACRO by Hayes ?

I just wanted to check if I need to run a linear regression separately if I am using PROCESS MACRO to run mediation analysis. Thank you.

02 March 2021 4,359 3 View

Sample dilution for quantitative analysis using ELISA?

If the detection range is in ng/ml but the reference range is in ug/ml for a molecule or protein in serum or plasma .how to dilute and what is the initial volume to be taken for quantitative analysis

02 March 2021 7,670 3 View

Chuck A Arize

There are several data analysis software for animal health economics. Some of them are:

R: R is a free software environment for statistical computing and graphics. It is widely used among animal health economists .
STATA: STATA is a general-purpose statistical software package that is widely used in animal health economics .
SAS: SAS is a software suite developed by SAS Institute for advanced analytics, multivariate analyses, business intelligence, data management, and predictive analytics .

Ma'Mon Abu Hammad

There are several data analysis software options available for conducting health economics analysis in the context of animal health. Here are a few commonly used software tools:

R: R is a free and open-source programming language widely used in data analysis and statistical modeling. It offers a vast range of packages and libraries specifically designed for health economics analysis, such as "HEAT" (Health Economics Analysis and Tools) and "farms" for farm-level economic analysis.

Stata: Stata is a popular statistical software package that provides a comprehensive suite of tools for data management, analysis, and visualization. It offers various modules and packages for conducting health economics research, including "ECONOMICS" and "HECON" for health economic modeling and analysis.

SAS: SAS is a widely used software suite for advanced analytics and data management. It provides a range of modules and procedures for health economics analysis, such as "SAS/ETS" (Econometrics and Time Series Analysis) and "SAS/STAT" (Statistical Analysis) that can be utilized for health economic modeling and analysis.

Excel: Microsoft Excel is a versatile spreadsheet software that can be used for basic data analysis and modeling. While it may not offer advanced statistical functions specific to health economics, it can be useful for basic calculations, graphing, and organizing data.

TreeAge Pro: TreeAge Pro is a specialized software for decision analysis and cost-effectiveness modeling. It provides tools for conducting economic evaluations, modeling clinical pathways, and performing sensitivity analyses.

These are just a few examples of software options commonly used in animal health economics analysis. The choice of software ultimately depends on the specific analysis requirements, your familiarity with the software, and the available resources. It's recommended to explore the features and capabilities of each software tool and consider factors such as data compatibility, statistical functions, and user-friendliness when making a selection.

Mohamad Alnakawa

First, it is necessary to define the purpose of the study, and then we can talk about the types