I am now using RiboMAX™ Large Scale RNA Production Systems to synthesis RNA. I anneal T7 promotr primer to ssDNA (66-mer primer), then use it as template for RNA synthesis. However, I got a very poor yield. The Ribomax kit says, typically, I should able to get 1ug/uL RNA. In this case, I got only 1ug/50uL after the Urea-PAGE purification.
Is it because I use ssDNA instead of dsDNA?
The following is my ssDNA sequence and T7 promoter sequence.
The use of these sequence is to synthesis eFx.
https://www.nature.com/articles/nmeth877#supplementary-information
ssDNA: ACCTAACGCTAATCCCCTTTCGGGGCCGCGGAAATCTTTCGATCCTATAGTGAGTCGTATTACGCC
T7 promoter: TAATACGACTCACTATAGG
use high quality of template or purified the template without any RNase contamination. you can use maximum template amount recommended by company. if you are getting the RNA through ssDNA , I think you can use.
Hi,
There can be dozens of reasons for poor yield from in vitro transcription. First, did you properly anneal oligos? Mix your oligos together at equimolar ratio in the presence of Mg2+ (I typically use 1 mM), boil at 90 celcius for 3 min, then gradually cool down to RT at -1 celcius per 45 sec. Second, you can increase the amount of the template, as Rakesh suggested. I use final conc of template of 50 ng/ul (~2.5 ug per 50 ul). Third, T7 transcription is very sensitive to the shortage of DTT, which tends to be easily depleted. Supplement the reaction with additional DTT at final 10 mM. Fourth, a typical T7 promoter sequence terminates with three contiguous Gs to maximize transcription efficiency, but yours has only two. Try the conventional one. Fifth, you may have RNase contamination of one of your reagents.
Problem solved. It is the secondary structure of ssDNA. The secondary structures stop the enzyme. Therefore I got poor yield.
Once I change the template to dsDNA, the yield increases 10 times more.
- Badges
- Science method