Could somebody please give me the nucleotide sequence of the TEV protease recognition site?

More Massimo Bogliolo's questions See All

Property of the harmonic mean?

The harmonic mean $$ of two positive numbers $x_1$ and $x_2$ can be written as a weighted average $=w_1 x_1+w_2 x_2$ where the weights are $w_1=x_2/(x_1+x_2)$ and $w_2=x_1/(x_1+x_2)$. As such...

17 April 2024 2,612 11 View

Papers presenting analyses and decisions with NO data: what do you think?

Many times I read interesting papers presenting analyses and decisions on Real Cases (with data) to support the “theory” BUT NO data are provided. In such cases there is NO possibility to analyse...

12 September 2023 8,708 1 View

Average Run Length? How to compute it?

On Wikipedia I found about ARL: Even when a process is in control (that is, no special causes are present in the system), there is approximately a 0.27% probability of a point exceeding 3-sigma...

06 November 2022 6,777 8 View

Does someone suggest where I can find the appropriate tools for performing a Quantum Transmission Photon Test similar to BB84?

I am looking to purchase the set of equipment related to the QKD BB84 performed in the laboratory. So, I will need a set of: - Polarization Filters - Photon Detector - Laser (one-by-one photons...

06 April 2022 5,152 0 View

Datasets on Semantic Similarity between Words/Concepts?

Are there available datasets quantifying semantic similarity for word pairs in English? Many thanks for your help!

08 January 2022 2,095 11 View

Can anyone help me with COMSOL RF boundary mode analysis?

My final goal is to propagare an RF surface wave on a purely reactive surface (Zsurf). First of all I run a mode analysis on a 2D rectangular geometry with a surface current (emw.E/Zsurf) on the...

16 November 2021 7,013 0 View

Single or multiple Voltage thresholds for successive APs in current clamp?

Hello everybody. We are trying to write a script to analyze current-clamp electrophysiological traces. I write asking for help because we stumbled on an issue that we couldn't really...

09 April 2020 8,958 0 View

Why my mESC won't attach to the plate?

I am culturing mESCs on 2i media. The cells are actively proliferating, but they barely attach to 0.2% gelatin- coated plates. Does anybody ever experienced similar issue and have some suggestions...

15 January 2020 5,936 6 View

Could anyone confirm please my identification of this species of freshwater bryozoans?

Hi, I attach an underwater picture of a colony of freshwater bryozoans. I identified it as Cristatella mucedo. I took the picture in a small natural lake in Northern Italy, in the Province of...

03 December 2019 7,882 2 View

Etiology of violence?

Have you collected data on the possible etiology of violence in offenders? Are there any recurrent biographical data in your sample? Let me know if you are interested in collaborating or at least...

01 August 2019 9,840 0 View

How to confirm the site-directed mutagenesis result without performing NGS?

I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...

08 August 2024 4,645 2 View

Are there instances where molecules with larger molecular weights exhibit greater mobility than those with smaller molecular weights?

Hi, I know that low molecular weight (MW) molecules generally tend to have higher mobility, while high molecular weight molecules tend to have lower mobility. However, in my experimental...

06 August 2024 1,495 2 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

Why did the authors extrapolate a phenotype that they experimentally proved in one bacterial strain across the whole genus of the organism?

I aim to be as skeptical as possible regarding whether a pair of orthologous genes results in the same phenotype in their different but related bacterial organisms under similar environmental...

05 August 2024 6,787 4 View

Why my colony PCR results of my recombinant bacterial not showing any results?

I am performing ligation of the plasmid and a target gene. The steps I have taken are: 1. Double digestion of the plasmid and target gene 2. Ligation of the plasmid with the target gene 3....

05 August 2024 2,570 3 View

The Curse of Evolution and Complexity?

Brain and body mass together are positively correlated with lifespan (Hofman 1993). The duration of neural development is one of the best predictors of brain size, and conception is the best...

05 August 2024 6,247 3 View

For an in-vitro drug release study, what molecular weight cut-off (MWCO) dialysis bag is required for a 117 kDa protein?

kindly reply me. Thanking you in advance.

05 August 2024 7,727 4 View

How to start a Molecular Dynamics Simulation?

Is it possible to conduct a molecular dynamics simulation to see the effects of a specific carbohydrate on the structure of lipids (e.g., micelle structure)? I am a beginner in this field and plan...

03 August 2024 3,371 3 View

How can we now if the promotor in the vector is well?

Hi, everyone. I want to transfer two genes in to the pseudomonas bacteria that isolated from the soil. The bacteria that I want to use for cloning haven't been identified and not be sequenced,...

02 August 2024 3,987 1 View

Which will be the best software for the Hydration shell analysis with molecular dynamics?

I am using a windows system, what software I should use for hydration shell analysis with molecular dynamics?

02 August 2024 3,143 4 View

Alejandro Martin

Take a look here: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3195948/

Specially the section on TEV.

Massimo Bogliolo

Thanks.

Ladislav Burysek

See also here: http://www.protean.cz/en/recombinant-protein/28/tev-protease

Mahmoud Kamal Ahmadi

I think it may be too late but it is "GAAAACCTGTACTTCCAAGCG"

Thanks. I appreciate it.

Anna Griego

Even if it is a little bit old just a question Mahmoud Kamal Ahmadi. I just checked you sequence and I saw that the last aminoacid is not a glycin but an alanine. This is not affecting the activity of the TEV?