I would like to use this sequence for TAP of protein complexes.
Take a look here: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3195948/
Specially the section on TEV.
Thanks.
See also here: http://www.protean.cz/en/recombinant-protein/28/tev-protease
I think it may be too late but it is "GAAAACCTGTACTTCCAAGCG"
Thanks. I appreciate it.
Even if it is a little bit old just a question Mahmoud Kamal Ahmadi. I just checked you sequence and I saw that the last aminoacid is not a glycin but an alanine. This is not affecting the activity of the TEV?
Human blood cells stabilised by RNA-Later to perform DNA expression studies. It is a good way to store white blood cells to perform subsequently the isolation of RNA? Or is it preferable to store...
23 June 2015 3,340 3 View
11 March 2015 1,728 4 View
When bone is cut by locking screws. In my experience in metaphyseal bone.
08 February 2015 5,366 2 View
I have a list of genes annotated with InterProscan. I would like to summarize the results plotting the GO category and look at which major function or biological processes those genes are involved...
12 August 2014 455 2 View
I have several clustering models to be tested and validated on images for which clusters inside are well known.
23 March 2014 7,277 2 View
Normally an academic dedicates do some hours per week to research, some to teach and some to administration of the Department or Faculty. Some hours are also dedicated to external work, as...
01 November 2013 4,783 3 View
I am trying to identify histone locus bodies in a prostate cancer cell line (PC-3)
09 July 2013 280 3 View
I am having a problem with the selection of my HEK-293 cells. I started the selection with G418 two months ago and I still have in my flask untransfected cells that don't die. What can I do? Try...
20 June 2013 1,849 19 View
I need to study these cells in whole blood samples. I normally use the protocol "Lyse-no-wash". It could be used to study these cells, too?
05 April 2013 5,771 10 View
Is there any evidence that telomere length in human skeletal muscles is limb specific?
03 April 2013 8,558 1 View
How to calculate the RMSD values for a MD simulation using MOE?
07 August 2021 0 0 View
When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.
16 June 2021 0 0 View
Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...
03 March 2021 5,978 5 View
Is it possible to induce site-directed substitution mutation by quick-change method on linear dsDNA? or it has to be cloned in some vector? If yes, should it be treated with the Dpn1 enzyme...
03 March 2021 401 4 View
Hi, I am trying to construct a multi-layer fibril structure from a single layer in PyMol by translating the layer along the fibril axis. For now, I am able to use the Translate command in PyMol...
02 March 2021 4,569 4 View
Question to you and THEM, the New Journal, "Integrative Psychological and Behavioral Science" -- do you not know, and have you not seen, this done before? There appears to be a core problem for...
02 March 2021 3,024 2 View